Busch Lab

ZMP

si:dkey-108f8.2

Ensembl ID:
ENSDARG00000074346
ZFIN ID:
ZDB-GENE-100922-38
Human Orthologue:
L3MBTL3
Human Description:
l(3)mbt-like 3 (Drosophila) [Source:HGNC Symbol;Acc:23035]
Mouse Orthologue:
L3mbtl3
Mouse Description:
l(3)mbt-like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2143628]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28666
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110260 Essential Splice Site 127 851 4 26
ENSDART00000125560 None None 574 None 17
ENSDART00000134448 None None 786 None 21
ENSDART00000147062 None None 119 None 4
Genomic Location (Zv9):
Chromosome 16 (position 28775201)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26650975
GRCz11 16 26524417
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACTAAACAGTCTGTATATACTTCTTGTTTGTTGAACTGTTGTGCAAAG[T/G]CAATATCATATTCGTGATCACACTAACATGCTGATTTCTGAAAACATCAT
Associated Phenotype:
Not determined