Busch Lab

ZMP

boc

Ensembl ID:
ENSDARG00000074335
ZFIN IDs:
ZDB-GENE-030131-6560, ZDB-GENE-030131-6560
Description:
brother of CDO [Source:RefSeq peptide;Acc:NP_001005393]
Human Orthologue:
BOC
Human Description:
Boc homolog (mouse) [Source:HGNC Symbol;Acc:17173]
Mouse Orthologue:
Boc
Mouse Description:
biregional cell adhesion molecule-related/down-regulated by oncogenes (Cdon) binding protein Gene [S

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa44130 Nonsense Mutation detected in F1 DNA Not yet available
sa37880 Nonsense Available for shipment Available now
sa37879 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44130
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111025 Nonsense 336 1032 7 19
ENSDART00000115000 Nonsense 336 1032 6 18
Genomic Location (Zv9):
Chromosome 24 (position 21831244)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21078373
GRCz11 24 21222792
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTACTTCTCTTGTGTTTCAGAGCCTCCTCAGGTGCGTGTGGAGCTGCAG[C/T]AGCAGGACGTGGCGTGGGGGGATACAGTGCGCTTCAGCTGTCAGGTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37880
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111025 Nonsense 458 1032 8 19
ENSDART00000115000 Nonsense 458 1032 7 18
Genomic Location (Zv9):
Chromosome 24 (position 21829153)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21076282
GRCz11 24 21220701
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCACCAGTGTCCACCAGTGCGGTGCTGCCCTTCGACTGCTCTGAAGTA[C/T]GAGTCTCTCCTGCTGAAGCTCCAGTCATTCTCAGTCAGCCGCGCACAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37879
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111025 Nonsense 528 1032 9 19
ENSDART00000115000 Nonsense 528 1032 8 18
Genomic Location (Zv9):
Chromosome 24 (position 21827628)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21074757
GRCz11 24 21219176
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACCAACACTATTTCAGGGTCTCAGCACAAGCTCATACTAACCAAACTG[C/T]AGCCTGCCAGCCTCTATGAAGTGGAAATGGCTGCTAGGAACTGTGCTGGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19340
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111025 Essential Splice Site 911 1032 16 19
ENSDART00000115000 Essential Splice Site 911 1032 15 18
Genomic Location (Zv9):
Chromosome 24 (position 21819008)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21066137
GRCz11 24 21210556
KASP Assay ID:
554-6207.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATTCCCAATGGAAAACATGCCGCTCAGCGCCTGCCACCTGGACACCAG[G/T]TATGACCACACACCAGCTTGACCAACAAACAAACAGTTCATCCAAAACTG
Associated Phenotype:
Not determined