Busch Lab

ZMP

arvcfa

Ensembl ID:
ENSDARG00000074329
ZFIN ID:
ZDB-GENE-091113-43
Human Orthologue:
ARVCF
Human Description:
armadillo repeat gene deleted in velocardiofacial syndrome [Source:HGNC Symbol;Acc:728]
Mouse Orthologue:
Arvcf
Mouse Description:
armadillo repeat gene deleted in velo-cardio-facial syndrome Gene [Source:MGI Symbol;Acc:MGI:109620]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa18632 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27526
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113728 Nonsense 167 819 4 16
ENSDART00000145220 Nonsense 125 771 2 14
Genomic Location (Zv9):
Chromosome 10 (position 480105)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 476878
GRCz11 10 478523
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAACCTACCATCCATCCTTTCCCACCAGAAACTATATACCAGAGAACTG[C/A]TACACGCTGCCGCTGCACCGGGACAGCTTTCCAAACCGGAAATCGGAGCA
Long Flanking Sequence:
GTCACGATCATCGGTCTCATGTGTAGTACGAGCTCGCGATAACATATGATGATGCTGTAGTGCTGTCCCATTATTTAGGGGTAAATGTCGATGCCCTTCCCCTTTCAAGGGCCAAAGGGAAGGGAAAGGATCTTTTGGAGAGGCGTTTAAAGATGGCCGCAGAGTGAAATGACTTACCTTAAGGGGACTTGGCTAAATGCGCTGACCTCTGTGTTTTTCTTTCTCCATCTACAGGAGAGTTCATGTGAAGAGTTGGACGACTCTCAGACATCATCTCCAGATGATCAGTGTGTAAATCAAGCAGAAGCTCCTGATGGATCTCCTGAAACGGAGGATCTTCCTCCTCATCCTGAACCCAGCTTGACGTCTGACCCTGCAAAGGAAGATCTTAAGGACCCGCTGGCTCTCTACAGTACACTACCAGCTCACAGCATGACCCTGCTGCACGGATTAACCTACCATCCATCCTTTCCCACCAGAAACTATATACCAGAGAACTG[C/A]TACACGCTGCCGCTGCACCGGGACAGCTTTCCAAACCGGAAATCGGAGCAGGATGTCTCCGCAGTCAGCCATCCCGTCCATCACATCCGGCCGACTCTGGATCTGTCAGCAGATGATCACCTGGCACCGCTGCAGCACGCGTATTTCCAAGACCTCTACCGGACACTCATCCCGCAGAAACGCGCCAGCATGGTCAGCCTGGACACCATCCGGAAGGACCCACGCTGGAGGGACCCAAACCTGCGGGAGGTCATCGCCATGCTGAGCCACCCCATGGACCCGGTGAAGTCTAACGCCGCCGCGTACCTGCAGCACCTCTGCTACGAGAACGATAAAGTCAAGCAGGACGTCCGGCAGCTGCGCGGGATCCCCGTCCTGGTGGGGCTCCTGGATCACCCCAAACCCGAGGTGCACCGTAAGGCCTGCGGAGCGCTCCGAAACATCTCCTTCGGCAGAGACAACTTCAACAAGGTGGCGATCAAGAACTCGGACGGCATCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18632
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113728 Essential Splice Site 697 819 12 16
ENSDART00000145220 Essential Splice Site 649 771 9 14
Genomic Location (Zv9):
Chromosome 10 (position 502085)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 498858
GRCz11 10 500503
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCATCCAGGGACAGGGCATYCAGAAACTGGTGTCAATCAACAGAACAAG[G/A]TGACCACCTGGCAACAAACACCATAGCAACARCATACAACACTATAACAC
Long Flanking Sequence:
TACTACACACACTTCTGTCCAAACAAGAGTTGATTATGCATCATAGGTGCTCTTTAAAGCCTCATGATTACACTTGTTGTTTCCTCAGTGGTCTAACTATATCCGGGCGACAGTGCGTAAGGAGAAGGGTCTGCCGGTGCTGGTGGAGCTGCTGCACTCGGATGCGGATAAAGTAGTGCGAGCTGTGGCCATCGCGCTCAGAAACCTGGCCATCGACCACAAGAACAAAGACCTGATCGGTAAGAGCAGCACTTTACTGTGGTGTTCTGCAGCAGAGCCTGTGCTGAGGCGGATCTGTGTCCTGCAGGGAGTTACGCCATGAGGGATCTGGTCAGCAACCTGCCCTGCGGCCAGCAGCGCCCCGCCAAAAACCTGGAGGGAGACACGGTAGTGGCCATCCTGAACACCATCCTGGAGATCATCTCCGAGAACCTGGAGAACGCCAGATTCCTCATCCAGGGACAGGGCATTCAGAAACTGGTGTCAATCAACAGAACAAG[G/A]TGACCACCTGGCAACAAACACCATAGCAACAACATACAACACTATAACACTATATACTACAGCCTAGCAACGCCACATCAATATGGTAAAATCCATTGAAAACACCTTGGCAACACCATAGCAACAACACAACACCCGACTAGTGCCAAACCAATATGGTAAAATACATTAAAAACACCATAGCAACACCATAGCAACAACACAACACCCCACTAGTGCCACAGCAATATGGTAAAATACATTGAAAACACCTTAGCAACACCATAGCAACAACACAACACCCGACCAGTGCCACAGCAACATGGTAAAATCTATTCAGAACACCTTAGCAACATTACAACAGCCTAGCAACGCCACATTAATATGGTAAAATACATTGAAAACACCTTAGCAACACCATAGCAACAACACAACACCTGACTAGTGCCACAGCAATATGGTAAAATCCATTGAAAACACCTTAGCAACACCATAGCAACAACACAACACCCGACCAATGC
Associated Phenotype:
Not determined