Busch Lab

ZMP

efcab2

Ensembl ID:
ENSDARG00000074323
ZFIN ID:
ZDB-GENE-070521-5
Human Orthologue:
EFCAB2
Human Description:
EF-hand calcium binding domain 2 [Source:HGNC Symbol;Acc:28166]
Mouse Orthologue:
Efcab2
Mouse Description:
EF-hand calcium binding domain 2 Gene [Source:MGI Symbol;Acc:MGI:1915476]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6142 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31010 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11337 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6142
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113669 Essential Splice Site 41 168 3 7
Genomic Location (Zv9):
Chromosome 17 (position 11364595)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11347117
GRCz11 17 11501183
KASP Assay ID:
554-3693.1 (used for ordering genotyping assays)
KASP Sequence:
ATGTTCTACAAACAAGGAAGACTTCTTTAATGTTRTCTGTCATTTTTCAC[C/T]GTAAAAGGGAAATAGGCACCATCATTCGTTCACTTGGCTGTTTTCCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31010
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113669 Essential Splice Site 130 168 6 7
Genomic Location (Zv9):
Chromosome 17 (position 11367085)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11349607
GRCz11 17 11503673
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAGGACACCTGGAACCAGCAGAACTGGCCAAATACTTAACACAAGAAG[G/A]TGAGACTATAACAAAGTGTTGTCCTGGATTTTAAGATTCTTCCAATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11337
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113669 Nonsense 156 168 7 7
Genomic Location (Zv9):
Chromosome 17 (position 11368350)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11350872
GRCz11 17 11504938
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATGAAATGCTGTCTGCTGCTGTTGATCCTGWTAAAAATGTCATTTTCTA[C/A]AAGGACTTTGTGAGCATGATGACTTATDATGACACCCGATAATCAAACAA
Associated Phenotype:
Not determined