Busch Lab

ZMP

sall1a

Ensembl ID:
ENSDARG00000074319
ZFIN ID:
ZDB-GENE-020228-2
Description:
sal-like protein 1 [Source:RefSeq peptide;Acc:NP_001139486]
Human Orthologue:
SALL1
Human Description:
sal-like 1 (Drosophila) [Source:HGNC Symbol;Acc:10524]
Mouse Orthologue:
Sall1
Mouse Description:
sal-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1889585]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa38627 Nonsense Mutation detected in F1 DNA Not yet available
sa11237 Nonsense Available for shipment Available now
sa40952 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38627
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111842 Nonsense 239 1313 2 3
Genomic Location (Zv9):
Chromosome 7 (position 38776441)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37113081
GRCz11 7 37384339
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCAGCCCTCATGGAGCAGCTCTTGGCCCTGCAGCAGCAGCAGATTCAC[C/T]AGCTACAGCTCATAGAGCAGATTCGTCACCAGATTCTTCTGTTAGCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11237
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111842 Nonsense 241 1313 2 3
Genomic Location (Zv9):
Chromosome 7 (position 38776447)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37113087
GRCz11 7 37384345
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCTCATGGAGCAGCTCTTGGCCCTGCAGCAGCAGCAGATTCACCAGCTA[C/T]AGCTCATAGAGCAGATTCGTCACCAGATTCTTCTGTTAGCCTCACAGTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2383
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111842 Nonsense 699 1313 2 3
Genomic Location (Zv9):
Chromosome 7 (position 38777823)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37114463
GRCz11 7 37385721
KASP Assay ID:
554-3344.1 (used for ordering genotyping assays)
KASP Sequence:
GTTGAGAACATMGACAGGAAGGTGGCAGATCCCAATGAGTGTGTTATCTG[T/A]CATCGTATTCTTAGTTGCCAGAGTGCRCTGAAAWTGCACTACCGCACGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40952
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111842 Nonsense 1215 1313 3 3
Genomic Location (Zv9):
Chromosome 7 (position 38781394)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37118034
GRCz11 7 37389292
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCTGTTAAGTTTCCTGAGCTCTTCCAAAAGGACCTATCCAGCAGGGCT[G/T]GAAACGGAGACCCAACCAGCTTCTGGAATCAGTATGCTGCTGCTTTCTCT
Associated Phenotype:
Not determined