Busch Lab

ZMP

si:ch73-270f14.4

Ensembl ID:
ENSDARG00000074313
ZFIN ID:
ZDB-GENE-081104-5
Description:
Novel protein similar to vertebrate neurotrophic tyrosine kinase, receptor, type 2 (NTRK2) [Source:U
Human Orthologue:
NTRK2
Human Description:
neurotrophic tyrosine kinase, receptor, type 2 [Source:HGNC Symbol;Acc:8032]
Mouse Orthologue:
Ntrk2
Mouse Description:
neurotrophic tyrosine kinase, receptor, type 2 Gene [Source:MGI Symbol;Acc:MGI:97384]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa39 Nonsense Confirmed mutation in F2 line Not yet available

Mutation Details

Allele Name:
sa39
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114940 Nonsense 223 238 6 6
ENSDART00000145594 Nonsense 223 385 6 8
Genomic Location (Zv9):
Chromosome 5 (position 57009452)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54961978
GRCz11 5 55632195
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGATATGTAACGCATCAGGTTCCCCGACCCCAGAGCTCACTTGGACCT[T/G]AAATTCCAGCGAACACCCTCCTCTCTCAACCAGCCACGAGGTAACACTCT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461