Busch Lab

ZMP

cnnm4

Ensembl ID:
ENSDARG00000074309
ZFIN ID:
ZDB-GENE-070705-181
Description:
Novel protein similar to human and mouse cyclin M4 (CNNM4) [Source:UniProtKB/TrEMBL;Acc:A5WWF8]
Human Orthologue:
CNNM4
Human Description:
cyclin M4 [Source:HGNC Symbol;Acc:105]
Mouse Orthologue:
Cnnm4
Mouse Description:
cyclin M4 Gene [Source:MGI Symbol;Acc:MGI:2151060]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa40371 Nonsense Mutation detected in F1 DNA Not yet available
sa45189 Nonsense Mutation detected in F1 DNA Not yet available
sa13735 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40371
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114069 Nonsense 236 769 1 8
ENSDART00000132406 Nonsense 237 602 1 4
Genomic Location (Zv9):
Chromosome 5 (position 14675298)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12972735
GRCz11 5 13472952
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGTAGGAAAGGAAACTATCTGTTGTGTTCGCTTCTTCTGGGAAATGTGT[T/A]GGTGAACACCACGTTAACCATCCTACTGGATGATCTCATTGGTTCAGGTT
Long Flanking Sequence:
CAGCAATGACACCTGGGCGCAGATTAAGTTCATGGAGCAGGGCGAGGACAGCAGCTCTGACTCCAACAGGACTTGTGCAGACTTCACCAAAGACATCTCTGTGAGGACTAGTATGAGTGTGAACAGCCTGGGAACGTCTGGTGTGCTGGGAGTCAAAATCAAACCACTTAGGAAAAGTGAGTCCCAGAGGGATTATGGGCTGTGCATCAGGCAGAACGGGAGGTGGTTTTCACTGGGAGAACATGATGGAAGGTTGCGTGTGGTGGAGGAGAAGAAGTCCATGCTGCCCATATGGTTCCAGGTGATCCTGATCTGCTGCCTCCTGGTGCTCTCAGGTATGTTCAGTGGGTTAAACTTGGGGCTGATGGCTTTGGATCCCATGGAACTGAGAATCGTCCAAAGCTGTGGGACGGATAAGGAGAAGAAGTATGCGAGGAAGATTGAACCCATTCGTAGGAAAGGAAACTATCTGTTGTGTTCGCTTCTTCTGGGAAATGTGT[T/A]GGTGAACACCACGTTAACCATCCTACTGGATGATCTCATTGGTTCAGGTTTGGGCGCTGTGGTGGCATCAACCATTGGCATTGTTATCTTTGGAGAGATTGTTCCTCAAGCGCTCTGCTCTCGCCATGGTTTGGCAGTAGGTGCCAACACCATCCACGTCACTAAGTTCTTCATGTTTCTGACTTTTCCGTTGTCTTATCCCATTAGCAAGCTTTTGGACTGCGTGTTGGGGCAGGAGATTGGCACGGTGTACAATCGGGAGAAGCTGGTGGGGATGCTGAAGGTGACCGAGCCATACAATGACCTGGTGAAGGAGGAGATGAACATGATTCAGGGCGCGCTGGAGCTGAGGACTAAAACTGTGGAGGACGTCATGACTCCGCTTAATAACTGCTTCATGATCAATAGTGATGCAGTTTTGGACTTCAACACCATGTCGGAGATCATGGAGAGCGGATACACGCGCATTCCTGTTTATGAGGATGAGAGGACCAACATTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26420
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114069 Essential Splice Site 451 769 1 8
ENSDART00000132406 Essential Splice Site 452 602 1 4
Genomic Location (Zv9):
Chromosome 5 (position 14675946)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12973383
GRCz11 5 13473600
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTCACGACACCAAGTTGGATTCAATGCTGGAGGAGTTTAAGAAAG[G/A]TTAGTGACTTTTTGTGTGTGTTTGTGTGTGTTTGTGTGTGTGTGTGTGTG
Long Flanking Sequence:
CACCATCCACGTCACTAAGTTCTTCATGTTTCTGACTTTTCCGTTGTCTTATCCCATTAGCAAGCTTTTGGACTGCGTGTTGGGGCAGGAGATTGGCACGGTGTACAATCGGGAGAAGCTGGTGGGGATGCTGAAGGTGACCGAGCCATACAATGACCTGGTGAAGGAGGAGATGAACATGATTCAGGGCGCGCTGGAGCTGAGGACTAAAACTGTGGAGGACGTCATGACTCCGCTTAATAACTGCTTCATGATCAATAGTGATGCAGTTTTGGACTTCAACACCATGTCGGAGATCATGGAGAGCGGATACACGCGCATTCCTGTTTATGAGGATGAGAGGACCAACATTGTGGACATCCTGTTTGTGAAGGACCTGGCCTTTGTGGATCCTGATGACTGCACCACTTTGAAGACCATCACTAAGTTCTACAACCATCCGGTTCACTTTGTGTTTCACGACACCAAGTTGGATTCAATGCTGGAGGAGTTTAAGAAAG[G/A]TTAGTGACTTTTTGTGTGTGTTTGTGTGTGTTTGTGTGTGTGTGTGTGTGTGCGTTTTTTTTCTTCTGCAGGTTTTCTCATTCTCTCTATATGTCTAATAGGTAGGCACAGACAGAATCTGCGGACGTTTTTTGCTATTTCTGTGAAGATTTTGGTAGCAAATCTGCGGATTTATGCGAAATGATTTTAGGAGTATCTTAATACTTAATCAGAGTTCATACGGTCATTGGAAACGTCATGGAATTTTGACATGGCATTTTCCAGTCCTGGAAAAGTTTTGGAAAAACCCACAAAGTTTTGTGAAAGACATGGAAAACATATATCTGTATACTTGAATATGAGTTAGTTTTCTTTACTTTTTTTTGTCCTTGTCCAATCACATACTCTCACATTATTAGTGCTGTGGTAGCATTATCCAAATCAATTTTGCATAGATATAAATATAAATTGAAACTAAATAGATTGCTGTGTGTTTTACAATATGCTGTAATAAATTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45189
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114069 Nonsense 490 769 2 8
ENSDART00000132406 Nonsense 491 602 2 4
Genomic Location (Zv9):
Chromosome 5 (position 14703670)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13001107
GRCz11 5 13501324
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCTGGGATTGGTCACTCTGGAGGACGTCATCGAGGAGATCATCAAATG[C/A]GAAATCCTGGACGAGTCTGACCTCTACAGTGAGTGGACAGTGGCAAAATC
Long Flanking Sequence:
TACTTGTGTTAATACATTGTTCTACATTTTACTTAAGCTTGATTAAATACATGCATGTAATCGCATCTGTAAATAATTTAATCTATAATTACACTGTTGACCATCCCTTACACCCTTAAACCTACCCAGACCACCAAAGCTGTGCCTAACCCTATATCTGCATCCCTTAAACCTCAGTAGCACCACAAGTGATCTGAAACGTATTATGAACACATTAAGTACATTGTATTTACATTTTGATGTATGTGCCTATTAGTTAAGAGCATGTAATATAAACTGGGACCATTTATTTTTTTATTTTATTGGATTGTAATGGTTTTGGTTTAGATCGGATTTATTTTCTGCCTTCTGCACTAATCCAAGTATTCGTCCGCCTCTTCTACAGGTAAATCCCATTTGGCGATTGTTCAGAAAGTCAATAATGAGGGCGAAGGAGATCCGTTTTATGAGGTGCTGGGATTGGTCACTCTGGAGGACGTCATCGAGGAGATCATCAAATG[C/A]GAAATCCTGGACGAGTCTGACCTCTACAGTGAGTGGACAGTGGCAAAATCAATGCGTTTATCTGTAATTATCCATACAACACTCGCACATCTAAAAGCAAACAGAGTTTGACTTTGACTGTTTCTGTACTGCAACGTAGACCATTTCGTGTGTGGTTTCACACAAACACACAGTTTATGAAGGCACTGACACATACAAATGTTTAAATAAAAGTGTATCATCATGTTAAGTGTATCATACAAATTCTGCATGATCATATTCTGCATCCCTAATCCTACCCTATACCTACTTTCTTAATTTTCTACTTTTGTAATTTTCTACTTTCTTAATAACTATTAATAAGCAGCAAATTGGCAGTGTATTTAGGAAAAAGTTAATGGTTTAGTAATAGTGATAATTGTACCTTAAAAGAAAAAAGTGTGGCCAAGTCCTATTTTTTTTTCTCCCGTTGTGCTCATATCAGTCTTTGTTTTTGTGTGTGTGTGTTCTTTGCAGCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13735
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114069 Essential Splice Site 763 769 None 8
ENSDART00000132406 None None 602 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 14749197)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13040480
GRCz11 5 13540697
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGAGACCACCTCGCTCCTCAACGAACAGAACAGCCAACCTGCYCGCCAGG[C/T]CAACCACAACACACACAACGAGAGTGCCATATGACACRCTYTCACACACA
Long Flanking Sequence:
AAAAGGTCTGTATGTGTGAAAGGGGCTATTGAGTGATCTCTGTGTCCCACGGTGCAGCCTTTTCATGTAGCTGACTCTATTGTGAGCATTACACTTGTATGTGTGATGCTCCCGTAACAGTAGTTCAACCTCTGATTCATTCATATGTTTTACGCAGCTGGAAAATTCTTGGGTTATAATTTGTCAGTTTATTTTATTTTTATTGAAAAATATATCTAGTGTCTGAATGATTTTAGGTTTGACTGCATCTCTCACCACCATTAATTCCATCTCTCCTGTTTTCCAGATCACGCGCTCTCAGTACCAAAACGGCCTGATGGCGTCTCGTCTGGACAGCTCTCCTCAGTCTCCAGACAGCGGACACGGCCGACAAGTGGACATGGACAACAGCACGTCGTCAGCTCCCCATCGCACTTCCGAAAACATGCTGACGCTCGCAGACGCCTCCGACGAGACCACCTCGCTCCTCAACGAACAGAACAGCCAACCTGCTCGCCAGG[C/T]CAACCACAACACACACAACGAGAGTGCCATATGACACGCTCTCACACACACACACGTCCCACACAACCACAGCACTTTTCCAGAACTTGTGTTCATCGAAAGCCCGTTTAGCTCTAGCCATCATAGCTCCCGGTGTAAACAGTGCGAGTCTATGAGGTGCAAACAAAAGATTTAACCTGCGAGACGAAGGCACAGAGAAGCCAAAGACTGAGAAAAAGACCCCCGTTTCGGACGGACTCTTTTATAGACTGATAGACTGATGGATAGAGACGTTTCTATATATATACATATATGAAGATGTTTATTTTGTCAGCCCATTTCGTTGCTCACGGAAGCTGAACGAGGGAACTGTGGATGCCTTTTTATTTCATGTTAGTCCATAGCTAATGCAAGTTTGTACTCTATTTGTGTGTGTGTGAGTGAAAGTGAGCGTGTTTGTGATAGAGATACATGGTGTGCCATTATGTTGTGTATGGCAAGCGGTTTTAACATTTATTTTA
Associated Phenotype:
Not determined