Busch Lab

ZMP

si:dkey-233k19.1

Ensembl ID:
ENSDARG00000074307
ZFIN ID:
ZDB-GENE-100922-160
Human Orthologue:
RAPGEF5
Human Description:
Rap guanine nucleotide exchange factor (GEF) 5 [Source:HGNC Symbol;Acc:16862]
Mouse Orthologue:
Rapgef5
Mouse Description:
Rap guanine nucleotide exchange factor (GEF) 5 Gene [Source:MGI Symbol;Acc:MGI:2444365]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa39094 Nonsense Mutation detected in F1 DNA Not yet available
sa16233 Essential Splice Site Available for shipment Available now
sa2850 Nonsense Available for shipment Available now
sa32084 Essential Splice Site Available for shipment Available now
sa22805 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39094
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114954 Nonsense 104 860 4 26
ENSDART00000138126 None None 364 None 12

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21000411)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19237166
GRCz11 16 19042805
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACATCTTTAACACTTTCCTGTGTTTGCTTTATATTATCAGGAGGACGTA[T/A]ATTGGTATAGAGCTGGTGGAATGGCTGATGGACCATTGCGAATTCATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16233
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114954 Essential Splice Site 198 860 None 26
ENSDART00000138126 None None 364 None 12

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21000933)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19237688
GRCz11 16 19043327
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCTTCAGCTGGTCCCACAYGAGCAGCTCTGTRGTGGAACCCAGAGGCGG[T/C]GAGCACATGGTTACACATAAAGCTTAATAATGGTGTTTTTTYCAAGGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2850
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114954 Nonsense 210 860 6 26
ENSDART00000138126 None None 364 None 12

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21006327)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19243082
GRCz11 16 19048721
KASP Assay ID:
554-2883.1 (used for ordering genotyping assays)
KASP Sequence:
TTTTTGCTTTGTAGCTGTAAAGAAGATAAACAGAAAACACCTGATGCTTG[T/A]AATCCAGTTCTTCAAATGAGGGCATTGGAGCATTTCACCTCAACAGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32084
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114954 Essential Splice Site 380 860 12 26
ENSDART00000138126 None None 364 None 12

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21081987)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19318742
GRCz11 16 19124381
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTCATTGGATCGTCTAATGTGTGTGTTACATGTTATGTTTATTTTCA[G/T]ATAGTCTGCTGGATGATTTTCTTCTGACGTACCCAGTGTTCATGTCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22805
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114954 Essential Splice Site 524 860 16 26
ENSDART00000138126 Essential Splice Site 28 364 2 12
Genomic Location (Zv9):
Chromosome 16 (position 21093778)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19330533
GRCz11 16 19136172
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGAGAGCTGGCATCCCATGAGGGGACCAGAGAGAGAGAGGAAAGAAGG[T/G]AAGCTCATAAAATATTCCTCTCATTTTTCTCTCATCACTCTCCGACTGCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7785
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114954 Nonsense 650 860 20 26
ENSDART00000138126 Nonsense 154 364 6 12
Genomic Location (Zv9):
Chromosome 16 (position 21101160)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19337915
GRCz11 16 19143554
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATGATATTGATTTTGATATTGTCCCCACCCTGCAGCAAGAGTTGGTGTA[T/G]TTTACTCTGAGTCGTGACTCAAGYTCTGGCCACACGGTGGCGCTGGAGCA
Associated Phenotype:
Not determined