Busch Lab

ZMP

si:ch73-194h10.1

Ensembl ID:
ENSDARG00000074283
ZFIN ID:
ZDB-GENE-100922-30
Human Orthologue:
INPP5D
Human Description:
inositol polyphosphate-5-phosphatase, 145kDa [Source:HGNC Symbol;Acc:6079]
Mouse Orthologue:
Inpp5d
Mouse Description:
inositol polyphosphate-5-phosphatase D Gene [Source:MGI Symbol;Acc:MGI:107357]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa18179 Nonsense Available for shipment Available now
sa40704 Nonsense Mutation detected in F1 DNA Not yet available
sa40705 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18179
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113405 Nonsense 362 1108 10 27
ENSDART00000137907 Nonsense 372 835 10 23

The following transcripts of ENSDARG00000074283 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 27870551)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28171762
GRCz11 6 28162323
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAAGTCACAGAAGATGCACAACAGACTTGTATTGGTGGTAGAGACAGAG[A/T]AAGGAAAAACTCAGAGCAAAGACTTTGTCTTTGAWGACACAAAGGTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40704
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113405 Nonsense 449 1108 12 27
ENSDART00000137907 Nonsense 459 835 12 23

The following transcripts of ENSDARG00000074283 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 27871552)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28172763
GRCz11 6 28163324
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGATGACACAGCCAATCAAATCCCACATGACATCTACGTAATCGGGACA[C/T]AGGAGGACCCACTGGGAGAGAAAGAGTGGATTGAGACAATTAGAGGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40705
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113405 Nonsense 952 1108 26 27
ENSDART00000137907 None None 835 None 23

The following transcripts of ENSDARG00000074283 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 27898648)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28199859
GRCz11 6 28190420
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTAATATGCTAAACTCAATCTTATTCTTGCTTTTAGACCTGTGGACGGT[C/T]AACCACCAGAGATGTTTGACAATCCTCTTTATGGCTCAATGAGTGGATCC
Associated Phenotype:
Not determined