Busch Lab

ZMP

si:ch211-157h5.2

Ensembl ID:
ENSDARG00000074275
ZFIN ID:
ZDB-GENE-090312-153
Description:
hypothetical protein LOC561940 [Source:RefSeq peptide;Acc:NP_001139049]
Human Orthologue:
LIMCH1
Human Description:
LIM and calponin homology domains 1 [Source:HGNC Symbol;Acc:29191]
Mouse Orthologue:
Limch1
Mouse Description:
LIM and calponin homology domains 1 Gene [Source:MGI Symbol;Acc:MGI:1924819]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa44508 Nonsense Mutation detected in F1 DNA Not yet available
sa16015 Essential Splice Site Available for shipment Available now
sa31201 Essential Splice Site Available for shipment Available now
sa15501 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44508
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113023 Nonsense 348 1660 9 25
ENSDART00000126770 None None 319 None 9
ENSDART00000132379 None None 1019 None 22

The following transcripts of ENSDARG00000074275 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 17749620)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18314788
GRCz11 1 19007725
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACCTGGATGGTTGAGAAAGGGGCGGAGCTTGATGAGGCGGAGCTTAAG[A/T]AAATGAGGAAGCTGGAAAAAGCGGGAATTAAAGTGTTACCCGCCGCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16015
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113023 Essential Splice Site 368 1660 9 25
ENSDART00000126770 None None 319 None 9
ENSDART00000132379 None None 1019 None 22

The following transcripts of ENSDARG00000074275 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 17749683)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18314851
GRCz11 1 19007788
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGAAAAAGCGGGAATTAAAGTGTTMCCCGCCGCTGTTCGATACAACAGG[T/A]CTGCGGTTGCAATGATAATATATATATTTAGCATGCGTCTGACTAAAACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25558
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113023 Essential Splice Site 578 1660 11 25
ENSDART00000126770 None None 319 None 9
ENSDART00000132379 None None 1019 None 22

The following transcripts of ENSDARG00000074275 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 17755029)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18320197
GRCz11 1 19013134
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTCAGACCTGGAGACATGGCAGAGACTGAAGATGAATACAGAGAGCAG[G/A]TGCCTCAATACAAACACTTAATCATTTAAACACTTAAACACTTAACCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31201
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113023 None None 1660 None 25
ENSDART00000126770 Essential Splice Site 175 319 4 9
ENSDART00000132379 Essential Splice Site 875 1019 17 22

The following transcripts of ENSDARG00000074275 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 17802223)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18367391
GRCz11 1 19060328
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTCAGGAGAGCCAGATCACAGCTACACCACAACTGCAGTTCATACAGG[G/A]TAAGACATGCACATATAAATCTCAAAGGGTTTCAATAGTAAACGGATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15501
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113023 None None 1660 None 25
ENSDART00000126770 Nonsense 181 319 5 9
ENSDART00000132379 Nonsense 881 1019 18 22

The following transcripts of ENSDARG00000074275 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 17803342)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18368510
GRCz11 1 19061447
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATGATTTCTCTGTYTCCCTGTGTGTTTTACAGATGGCTCGTGGAGCTG[C/A]AAGTCTAAAGGCAGGCAGGAGGATCTGAAGAAAACCGCYTCGCTGGATCG
Associated Phenotype:
Not determined