Busch Lab

ZMP

zgc:172302

Ensembl ID:
ENSDARG00000074221
ZFIN ID:
ZDB-GENE-081205-5
Description:
Zgc:172302 protein [Source:UniProtKB/TrEMBL;Acc:B5DDZ5]
Human Orthologue:
ABCA7
Human Description:
ATP-binding cassette, sub-family A (ABC1), member 7 [Source:HGNC Symbol;Acc:37]
Mouse Orthologue:
Abca7
Mouse Description:
ATP-binding cassette, sub-family A (ABC1), member 7 Gene [Source:MGI Symbol;Acc:MGI:1351646]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa41770 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24886 Nonsense Mutation detected in F1 DNA Not yet available
sa45420 Nonsense Mutation detected in F1 DNA Not yet available
sa41771 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41770
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113281 Essential Splice Site 101 1165 4 46
Genomic Location (Zv9):
Chromosome 11 (position 5674884)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5644340
GRCz11 11 5590646
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTTTTTTTTAACTTCAGCCATTGATGGAGATTTATTTTGTTATTTTC[A/T]GACTTTCTCGACTTTTAGTCGATATGAGGACCGTCCTGACAATCAGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24886
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113281 Nonsense 236 1165 6 46
Genomic Location (Zv9):
Chromosome 11 (position 5680622)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5650078
GRCz11 11 5596384
KASP Assay ID:
554-7304.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGGGGGCGCTGTGTGTTGTGCCCTCAGATATTATGCAGAAGGCAGAG[C/T]AAATCTTCCTCTCACAGCTGGACTTCAGCAAGATTGTTACGGTTAGTGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2622
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113281 Nonsense 445 1165 10 46
Genomic Location (Zv9):
Chromosome 11 (position 5684695)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5654151
GRCz11 11 5600457
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACCCAGAATCAAAACGTTCATGGAGAGCAGTGTAGAAATTCGGCTTCTG[C/T]AGGATCTTCTGAGAAGGCCTGAGGTGGCTGTAATAGTGAACATGCGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45420
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113281 Nonsense 718 1165 14 46
Genomic Location (Zv9):
Chromosome 11 (position 5700990)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5670446
GRCz11 11 5616752
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTATTAAGCTTTGTGTCTCTCTGCTGTCTCTTGCAGTGGGGAGATATTT[T/A]ACCCTACAGTGACCCGGCTGTTGTGTTCTTCTTCCTGGCTGCGTTTGCTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4401
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113281 Nonsense 957 1165 18 46
Genomic Location (Zv9):
Chromosome 11 (position 5706374)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5675830
GRCz11 11 5622136
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTCATTCAATACTTYATGATTTGACTCACAGGTCCATTCTAACAGGAT[T/A]GTTTCCTCCTACYGCTGGTACCATATWCGTGAAGGGAATGGACATTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41771
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113281 Essential Splice Site None 1165 41 46
Genomic Location (Zv9):
Chromosome 11 (position 5734404)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5702515
GRCz11 11 5648715
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGTTTTACGCTCGCCTCAGAGGAGTGCCCGAGTCTTATGTTGAAAAG[G/A]TACAGGATGCTCCAAGCACATCATAATAAATATCTGAGTTAGTATTACTA
Associated Phenotype:
Not determined