Busch Lab

ZMP

zgc:171516

Ensembl ID:
ENSDARG00000074219
ZFIN ID:
ZDB-GENE-070928-11
Description:
hypothetical protein LOC100126011 [Source:RefSeq peptide;Acc:NP_001099161]
Human Orthologue:
MAP3K3
Human Description:
mitogen-activated protein kinase kinase kinase 3 [Source:HGNC Symbol;Acc:6855]
Mouse Orthologue:
Map3k3
Mouse Description:
mitogen-activated protein kinase kinase kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1346874]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32485 Nonsense Available for shipment Available now
sa17108 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32485
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113107 Nonsense 55 300 4 13
ENSDART00000137366 Nonsense 60 306 4 13
Genomic Location (Zv9):
Chromosome 24 (position 20872467)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20119596
GRCz11 24 20264015
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAGAGCAACAACAGCAACAAGCCCAAGAGCAGAAGCCCGTCGTACAGA[C/T]AGGTAATTATTACCCACAATGCACCAGTCAGCACCAGCTAACATTGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17108
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113107 Essential Splice Site 224 300 10 13
ENSDART00000137366 Essential Splice Site 229 306 10 13
Genomic Location (Zv9):
Chromosome 24 (position 20849478)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20096607
GRCz11 24 20241026
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AWGCACAAACTCYAATGMAGGGAAATGATGTCWTGTGTGTTTTTGTGTGC[A/T]GATTATGGAGCCGTTYGGCAGCGCTAMTGGGTCRCTTTCCAGCAGCTGTC
Associated Phenotype:
Not determined