Busch Lab

ZMP

SLC5A10

Ensembl ID:
ENSDARG00000074212
Description:
solute carrier family 5 (sodium/glucose cotransporter), member 10 [Source:HGNC Symbol;Acc:23155]
Human Orthologue:
SLC5A10
Human Description:
solute carrier family 5 (sodium/glucose cotransporter), member 10 [Source:HGNC Symbol;Acc:23155]
Mouse Orthologue:
Slc5a10
Mouse Description:
solute carrier family 5 (sodium/glucose cotransporter), member 10 Gene [Source:MGI Symbol;Acc:MGI:19

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa19416 Essential Splice Site Available for shipment Available now
sa19417 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3353
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112160 Essential Splice Site 77 642 4 17
ENSDART00000112160 Essential Splice Site 77 642 4 17
Genomic Location (Zv9):
Chromosome 1 (position 7140449)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7429358
GRCz11 1 8113469
KASP Assay ID:
2259-0147.1 (used for ordering genotyping assays)
KASP Sequence:
GGGGACCGGAGCCGCGGGAGGAATYGCTGTGGCCGGATTTGAATGGAATG[T/A]GAGTGACATCATTTTCAAAAGCYATTCCTAAATATCTCATAGACTTATTT
Long Flanking Sequence:
AGCTAACTCCCATAGAATATGTTTCTATGTGCATAAAAACTTTTGCAAATGTAATTTGACAGACAGCAAAATATCTTTAAAAAAAGGAAGTCATATAATCAGATTACAGTTTTAATCACGTTTTTTCAGTTTATTAATTTATATGTACTTATTTCTACATTTAAATCCTGTGCTCTCAATTTAAACTAATTCACAAAGCAAATGAGCTCAAACCAATATAAAAATACATATAAATATTATCCACACAAGACATGCATATAAATAAATAATATTATAATTTAAATATAAAAATATATCTGTCATAAACCAGCTGCAGAAACTATAAATAGGTTGTAAATAGCAGAAGAGTTGTAAATCCTCTTGTTTTATGTGTGGGTCTGAACTGTGTGTGCAGATCGGCGCGTCTCTGTTCGCCAGCAGCGAGGGCTCCGGGCTCTTCATCGGTCTGGCGGGGACCGGAGCCGCGGGAGGAATCGCTGTGGCCGGATTTGAATGGAATG[T/A]GAGTGACATCATTTTCAAAAGCTATTCCTAAATATCTCATAGACTTATTTTTTATTCAACATTACAATATGAGCATGAATAAAACAAAAATGCACTTTCATTTGCTGACCACTAGAGGAGGCAAAAGGACCAGATTCTGTTTTGAAAAGGAGCTTATGCGTGATATAAATGTCTGTCAAAAAACATTAAATTAAATCATGAATGCAAATTTGATAAACTACATATACAGGACAAAAACATAGTGCTTAGTTAACAAGTGCTTATTTTGTTTTTTAAAACTAACAGCCTATACTTAAAAACATCATTACAAAATTTTTGCCGTTATTTTAGTAAGTTTAAAGAGATAGTTCAGCCAAAACAATGAACCAAAACAATGAACAAGTGATAATTCTAGCATCATTTGCTCTCACTTTCCTTAACATAAGAAGTTATTATGGAAAATGCTGGATGCCTGTAACCCTTGAGACTTCAGTAGTATTTGTTTTTGGAAGTCAGGGGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18684
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112160 Essential Splice Site 77 642 4 17
ENSDART00000112160 Essential Splice Site 77 642 4 17
Genomic Location (Zv9):
Chromosome 1 (position 7140449)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7429358
GRCz11 1 8113469
KASP Assay ID:
2259-0147.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGGACCGGAGCCGCGGGAGGAATCGCTGTGGCCGGATTTGAATGGAATG[T/A]GAGTGACATCATTTTCAAAAGCTATTCCTAAATATCTCATAGACTTATTT
Long Flanking Sequence:
AGCTAACTCCCATAGAATATGTTTCTATGTGCATAAAAACTTTTGCAAATGTAATTTGACAGACAGCAAAATATCTTTAAAAAAAGGAAGTCATATAATCAGATTACAGTTTTAATCACGTTTTTTCAGTTTATTAATTTATATGTACTTATTTCTACATTTAAATCCTGTGCTCTCAATTTAAACTAATTCACAAAGCAAATGAGCTCAAACCAATATAAAAATACATATAAATATTATCCACACAAGACATGCATATAAATAAATAATATTATAATTTAAATATAAAAATATATCTGTCATAAACCAGCTGCAGAAACTATAAATAGGTTGTAAATAGCAGAAGAGTTGTAAATCCTCTTGTTTTATGTGTGGGTCTGAACTGTGTGTGCAGATCGGCGCGTCTCTGTTCGCCAGCAGCGAGGGCTCCGGGCTCTTCATCGGTCTGGCGGGGACCGGAGCCGCGGGAGGAATCGCTGTGGCCGGATTTGAATGGAATG[T/A]GAGTGACATCATTTTCAAAAGCTATTCCTAAATATCTCATAGACTTATTTTTTATTCAACATTACAATATGAGCATGAATAAAACAAAAATGCACTTTCATTTGCTGACCACTAGAGGAGGCAAAAGGACCAGATTCTGTTTTGAAAAGGAGCTTATGCGTGATATAAATGTCTGTCAAAAAACATTAAATTAAATCATGAATGCAAATTTGATAAACTACATATACAGGACAAAAACATAGTGCTTAGTTAACAAGTGCTTATTTTGTTTTTTAAAACTAACAGCCTATACTTAAAAACATCATTACAAAATTTTTGCCGTTATTTTAGTAAGTTTAAAGAGATAGTTCAGCCAAAACAATGAACCAAAACAATGAACAAGTGATAATTCTAGCATCATTTGCTCTCACTTTCCTTAACATAAGAAGTTATTATGGAAAATGCTGGATGCCTGTAACCCTTGAGACTTCAGTAGTATTTGTTTTTGGAAGTCAGGGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19416
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112160 Essential Splice Site 168 642 8 17
Genomic Location (Zv9):
Chromosome 1 (position 7150473)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7439382
GRCz11 1 8123493
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACCATCAAGAGAGAATTGAGCAAGAACCTTTCAGTCCTGTGTTTCTGC[A/T]GGTGGCTTGGCTGCTGTAATCTACACCGACACTCTTCAGACCTTCATCAT
Long Flanking Sequence:
AAAACTACAAGAATAATCTTGTAGAACAGCTTTTTACGTCACACCGCACTGCACACACAGATTTACAGCCAAGCGAGCAGATGTGATATTCTCTGTAAACATGGATGGAGTGGAATACTGGTTAAAGCTTATGGTTTGCATCAAGAATGTTGTTCGTTTGGTTACTGCAAAGTGCAAATTACAAACTAAGAGTCCTCAATCAAGCTCCTTAACCACAAGTTTGAGTGCTACTGTAAATTGTTTTGGATGAAAGCTTCTAACTGTTTGAACTCTCCCGGTGAAGTCCAGAGGTTCAGTAAGAGTTAATTTCTCCAGCAGTAATTATAGTCTACATGACTGATTCCAGCATAATTGCATAATTACATTAATCCGCCGCTCTGCTGTCACCGTATTCACTCCTCTGTCTACAAGTGCTGATTCAGACTTGACCCTGATGACTCAGATCACATTAAACCATCAAGAGAGAATTGAGCAAGAACCTTTCAGTCCTGTGTTTCTGC[A/T]GGTGGCTTGGCTGCTGTAATCTACACCGACACTCTTCAGACCTTCATCATGATCATCGGAGCTGTCATCCTCACCATCACGGGTTAGTCAGTCTCCGGCCACTTCTTTTATTCTGAACCGGCAGTGATCTAACATCAGCTGACACTATAGGGAAGAGAGAACGTTGAGAAAGTGGCAATGGCAATGTAGAAGGCCAGCTGTGAGTTTGACATATGTGACCCTGGACCACAAAAGCAGTCTTATGCTGTATGGGTATATGCTTTTATGCCAAAAAATCATTAGAATTTTAGGTGAAGATCATGCTCCATGAAGATACTTGGTACATATAAACGCAAATATCAGCAATCTACTTTTGATTAGTAATGTGCAATGCTATCAGTGATGGAAAGAATACTAAAAAAAAGTCCCATTACTTGCCTAAAAATGTAGTGCAAATAGAGTGAAAGTATCTGTTGATACTAAAAAAATACTCAAATTATGATTAAAAAACTAGACCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19417
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112160 Nonsense 382 642 12 17
Genomic Location (Zv9):
Chromosome 1 (position 7171100)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7460009
GRCz11 1 8144120
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTCAACAGCAGCAGCACCCTCTTCACCATGGACATCTGGAAGAAATAT[C/T]GAAGAGGTGCAAGCGAAAAAGAGCTGCTACTTGTTGGCAGGTATTAATAT
Long Flanking Sequence:
TATTTTTAAATCAAGACATTTTTAACAAATAATAAAAAATAATGATGCAGTTTTTTCAAACTAAAGGAATGTTTTCTGTCTCTTAAAAAAAGGTTTTCACAATTTTTCCCCGAATAAGGGGAATAAACCTAATATAAATAGCTGCATTGAAAAAACTTATTTTTTCTCAGACACAGTGGCTTGTGTGGACCCTGAAGAGTGTGTGAAGGTGTGTGGCGCAGAGGTGGGCTGCTCCAACATTGCTTTTCCTAAACTGGTCATCGAACTCATGCCTAGCGGTAATCAGGAGCTCTTATTCTTTTTCACATTAAGCATTTTGATTGTCATTACATATTTTATCAAGTGTGTCATGAACGTTAATAATCATGCAGTTGTAAACATGTATTCCAGGCCTTCGGGGGTTAATGATAGCTGTAATGATGGCCGCATTGATGTCATCACTTACCTCCATCTTCAACAGCAGCAGCACCCTCTTCACCATGGACATCTGGAAGAAATAT[C/T]GAAGAGGTGCAAGCGAAAAAGAGCTGCTACTTGTTGGCAGGTATTAATATTTGTTCATGACTGCTTTTGACAAGTTATCCAGGAACCTGTGTCAGCTATTAAAAATGATCAATCATTATGACATGCATTAAGATAACATGTTGTCTAAGATCCAACATTACGGTGTTTGGTGCAAAAGCTATCACAGGAAAGAATGTCGAAATTATTTTTGGCATTAGAAATGCAATCCAAAATCGTGATAAGAAATATATATTAATCATTTAGATTAGCTTGTAACTCGTTTGTCATTAGCTGAGATCAGTTTATGAAAATAAAACCAAAAGTTTTCTTTATTTAATTAGACTATTGAAGATTAGTAGCCAAATATCATATCTGAAAATAAAATAAAAATAAATATGTCTGGAAAGTATTCATAGCGCTTCACTTTTTCCAAATTTTTTTTATGTTGCAGCCTTATTCCAAAATGGATTAAATTAATTTATTTCCTCAACATTCTACAC
Associated Phenotype:
Not determined