Busch Lab

ZMP

ENSDARG00000074206

Ensembl ID:
ENSDARG00000074206

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa24753 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24753
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114889 Essential Splice Site 773 967 6 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3530 (position 1118171)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 65499251
GRCz11 4 67788103
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTCTCTGAACAACTGGAGGATCCAAACTACACACTGGACACACTCAAG[T/G]AAGTGGAGCATCACTGGCCTTGTGCTTTTACACTGAATGGCTTTAAAAAG
Associated Phenotype:
Not determined