Busch Lab

ZMP

si:dkey-269g4.4

Ensembl ID:
ENSDARG00000074184
ZFIN IDs:
ZDB-GENE-060810-36, ZDB-GENE-091204-147
Human Orthologue:
ARHGAP32
Human Description:
Rho GTPase activating protein 32 [Source:HGNC Symbol;Acc:17399]
Mouse Orthologue:
Arhgap32
Mouse Description:
Rho GTPase activating protein 32 Gene [Source:MGI Symbol;Acc:MGI:2450166]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa37309 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18166 Nonsense Available for shipment Available now
sa43646 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37309
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058370 Essential Splice Site 97 1950 4 24
ENSDART00000132533 Essential Splice Site 97 1908 4 22
Genomic Location (Zv9):
Chromosome 21 (position 23890053)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 24575727
GRCz11 21 24612332
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTGAATATTGAGCTTGATTTTTTATTTATTTTTTTATTGATGTTTTTA[G/A]GCTGTCATTCACCAAGGGCCATTTTCCAAAGTTAGCTGAATGTGCCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18166
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058370 Nonsense 1302 1950 24 24
ENSDART00000132533 Nonsense 1260 1908 22 22
Genomic Location (Zv9):
Chromosome 21 (position 23819566)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 24505240
GRCz11 21 24541845
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATGGGAAGCCATAAAGCCTGTCCATCCAAAAGGAGATAGTGCTTCTCAA[C/T]AACACCACACTCAGGGAGTGACACCACCAACACCCCCTATTCGCTCGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43646
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058370 Nonsense 1721 1950 24 24
ENSDART00000132533 Nonsense 1679 1908 22 22
Genomic Location (Zv9):
Chromosome 21 (position 23818307)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 24503981
GRCz11 21 24540586
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCAGCATGCTCCCAGACACTTGATCTCTGATCCAGATGTCCTAATGTA[T/A]ATGGAAACAGAGAAGCACTGCCAAGGAAATGGAATGGGGGAGAAAACCAC
Associated Phenotype:
Not determined