Busch Lab

ZMP

si:dkey-172j4.3

Ensembl ID:
ENSDARG00000074183
ZFIN ID:
ZDB-GENE-081104-24
Description:
Novel protein similar to vetebrate diacylglycerol kinase, delta 130kDa (DGKD) [Source:UniProtKB/TrEM
Human Orthologue:
DGKH
Human Description:
diacylglycerol kinase, eta [Source:HGNC Symbol;Acc:2854]
Mouse Orthologue:
Dgkh
Mouse Description:
diacylglycerol kinase, eta Gene [Source:MGI Symbol;Acc:MGI:2444188]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa11908 Nonsense Available for shipment Available now
sa38605 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31567 Nonsense Available for shipment Available now
sa40878 Nonsense Mutation detected in F1 DNA Not yet available
sa18053 Nonsense Available for shipment Available now
sa34055 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11908
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049885 Nonsense 153 1074 4 28
ENSDART00000134535 Nonsense 93 1014 3 27
Genomic Location (Zv9):
Chromosome 7 (position 24850932)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23412684
GRCz11 7 23683841
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAGCAGGAAGGAGATGGAAGACTGGATCAGTGCTTTGAAGTCTGTACAG[A/T]AATGGGAAACATACGAGGTCTGAACCTTCWCTTTTCACCTTTGGAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38605
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049885 Essential Splice Site 159 1074 5 28
ENSDART00000134535 Essential Splice Site 99 1014 4 27
Genomic Location (Zv9):
Chromosome 7 (position 24853421)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23415173
GRCz11 7 23686330
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGTTGAATATTTATAGCACACTGATGCTGACACGATTTGTCTGATTCC[A/G]GGCCAGTCAGTTCAACATGGAGCACTTCTCCGGGATGCATAACTGGTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31567
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049885 Nonsense 207 1074 6 28
ENSDART00000134535 Nonsense 147 1014 5 27
Genomic Location (Zv9):
Chromosome 7 (position 24853841)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23415593
GRCz11 7 23686750
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTCATTTCATCCCATCTCCCTGTTTGTGTGTGTTAGTGTGTAAGTTC[A/T]AAGCCCACAAGCGCTGTGCCGTACGATCCACCAATACCTGTAAATGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40878
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049885 Nonsense 246 1074 7 28
ENSDART00000134535 Nonsense 186 1014 6 27
Genomic Location (Zv9):
Chromosome 7 (position 24855706)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23417458
GRCz11 7 23688615
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTAAATGTGTGTGTCTGTGTGTGCAGGTGTCAATGCCTCACCAGTGGT[T/A]GGAGGGAAACCTGCCGGTCAGCGCTAAGTGTGTGGTGTGCGATCGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18053
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049885 Nonsense 881 1074 23 28
ENSDART00000134535 Nonsense 821 1014 22 27
Genomic Location (Zv9):
Chromosome 7 (position 24880489)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23442241
GRCz11 7 23713398
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCACGCTGAARTCATGGGAGGACAAGCGTAAAGGTGACAGCCGGCCRTCT[C/T]GACCACGACTCAACTCCCAACAGTCTATGGAGTAYCTGACGGAGGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34055
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049885 Nonsense 887 1074 23 28
ENSDART00000134535 Nonsense 827 1014 22 27
Genomic Location (Zv9):
Chromosome 7 (position 24880507)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23442259
GRCz11 7 23713416
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGACAAGCGTAAAGGTGACAGCCGGCCATCTCGACCACGACTCAACTCC[C/T]AACAGTCTATGGAGTATCTGACGGAGGAGGAATGTGCTCAGGTCCAGCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2400
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049885 Nonsense 1011 1074 26 28
ENSDART00000134535 Nonsense 951 1014 25 27
Genomic Location (Zv9):
Chromosome 7 (position 24886055)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23447807
GRCz11 7 23718964
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGTGGAGARTCTCAGCGCTGAATTACAGAAGCTGGAGGACATTCATTG[G/A]ATCTGTCCCAGCATGCACTGCTCTGAGGAGGTATGTGCCAGCTWATTGCA
Associated Phenotype:
Not determined