Busch Lab

ZMP

si:dkey-46a10.2

Ensembl ID:
ENSDARG00000074170
ZFIN ID:
ZDB-GENE-081104-415
Description:
Novel protein similar to vertebrate F-box protein 4 (FBXO4) [Source:UniProtKB/TrEMBL;Acc:A8Y5U0]
Human Orthologue:
FBXO4
Human Description:
F-box protein 4 [Source:HGNC Symbol;Acc:13583]
Mouse Orthologue:
Fbxo4
Mouse Description:
F-box protein 4 Gene [Source:MGI Symbol;Acc:MGI:2146220]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa31662 Missense, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31662
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108731 Missense 65 369 2 7
ENSDART00000141799 Missense 65 361 2 7
ENSDART00000147730 Nonsense 50 96 2 5
Genomic Location (Zv9):
Chromosome 8 (position 32544239)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31686965
GRCz11 8 31696197
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGTTCCTCATCATGACCTTCCTGTCTCCGCAAGACCTCTGCAGACTG[G/A]GAGGCACCAGCACATACTGGCGGTCAATGGTTCGAGACCCTGTCCTGTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3675
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108731 Essential Splice Site 342 369 6 7
ENSDART00000141799 Essential Splice Site 342 361 6 7
ENSDART00000147730 None None 96 None 5
Genomic Location (Zv9):
Chromosome 8 (position 32495194)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31637920
GRCz11 8 31647152
KASP Assay ID:
2260-0820.1 (used for ordering genotyping assays)
KASP Sequence:
GACTATCGCCCATCAGCTTCAGCTAAGCTCACTTGTCAACCCCTGGATGG[T/A]AAGATATCAAAACCAACTTGTTCACATTTGATGAGACTTGACTAAACTTT
Associated Phenotype:
Not determined