Busch Lab

ZMP

si:ch211-204d2.5

Ensembl ID:
ENSDARG00000074168
ZFIN ID:
ZDB-GENE-041111-225
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A9C3U2]
Human Orthologue:
C10orf18
Human Description:
chromosome 10 open reading frame 18 [Source:HGNC Symbol;Acc:23484]
Mouse Orthologue:
BC016423
Mouse Description:
cDNA sequence BC016423 Gene [Source:MGI Symbol;Acc:MGI:2145274]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa41133 Nonsense Mutation detected in F1 DNA Not yet available
sa38672 Nonsense Mutation detected in F1 DNA Not yet available
sa21207 Nonsense Available for shipment Available now
sa16911 Nonsense Available for shipment Available now
sa41134 Nonsense Mutation detected in F1 DNA Not yet available
sa9993 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41133
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111957 Nonsense 105 2967 4 24
ENSDART00000137039 Nonsense 105 175 4 6
ENSDART00000141560 None None 104 None 2
ENSDART00000147817 None None 1186 None 6

The following transcripts of ENSDARG00000074168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11507301)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11161823
GRCz11 8 11199528
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTTCCTCCACAGGCAAGGAAAGTTGGTGAAACAGGCTTGTTGGTTGGG[C/T]GAGCGAAATGCTCCACCCTTGGAGACTCCTTGAAAGGTAAGGAAAGCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38672
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111957 Nonsense 794 2967 15 24
ENSDART00000137039 None None 175 None 6
ENSDART00000141560 None None 104 None 2
ENSDART00000147817 None None 1186 None 6

The following transcripts of ENSDARG00000074168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11516002)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11153122
GRCz11 8 11190827
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAAGGCGTAAAAGATTGTGGAGTCCTGATGCCACTCTGAAACGTTCTT[T/G]AAGATCAAATACTGCAAAGAATGAAAATGAGTCTATAGCAGACCCTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21207
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111957 Nonsense 1512 2967 17 24
ENSDART00000137039 None None 175 None 6
ENSDART00000141560 None None 104 None 2
ENSDART00000147817 None None 1186 None 6

The following transcripts of ENSDARG00000074168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11520423)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11148701
GRCz11 8 11186406
KASP Assay ID:
2260-0197.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCAACAAAGCATTCATCTGCTGGGACAAGTGGCTCCCCAAGTCAAGTT[G/T]AAGCCTTGATGGTAACTGTATTGTACAATTTTTGTTACACTGTTCACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16911
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111957 Nonsense 1548 2967 18 24
ENSDART00000137039 None None 175 None 6
ENSDART00000141560 None None 104 None 2
ENSDART00000147817 None None 1186 None 6

The following transcripts of ENSDARG00000074168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11520657)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11148467
GRCz11 8 11186172
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGACACGGACACTGATGAAGAAAATGATATCGCCACTGACCACTCCTA[T/G]TCTCAGATTATGGAAGGAAACAGTGCGTACACCCAGTTGTGTGATCAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41134
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111957 Nonsense 2126 2967 19 24
ENSDART00000137039 None None 175 None 6
ENSDART00000141560 None None 104 None 2
ENSDART00000147817 Nonsense 345 1186 1 6

The following transcripts of ENSDARG00000074168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11522563)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11146561
GRCz11 8 11184266
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGGCCAACAAGATGTATCTGAAGCCAGAAGGGAGGAGGATACACTTGTT[G/T]AGAAGATTGAGACACAATCCATTCAGCGTTTGTCTCCCAAAATTGGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9993
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111957 Nonsense 2188 2967 19 24
ENSDART00000137039 None None 175 None 6
ENSDART00000141560 None None 104 None 2
ENSDART00000147817 Nonsense 407 1186 1 6

The following transcripts of ENSDARG00000074168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11522751)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11146373
GRCz11 8 11184078
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACAGCATGTGCTCTACTCCTACTCAAGATGAAATTCCTGAAATATGTTA[T/A]CCAGAAGTAAACAAAGAGTTGAGGGTAGAAGATCTGGACAGAAAACTKTG
Associated Phenotype:
Not determined