Busch Lab

ZMP

birc6

Ensembl ID:
ENSDARG00000074166
ZFIN ID:
ZDB-GENE-091202-7
Human Orthologue:
BIRC6
Human Description:
baculoviral IAP repeat-containing 6 [Source:HGNC Symbol;Acc:13516]
Mouse Orthologue:
Birc6
Mouse Description:
baculoviral IAP repeat-containing 6 Gene [Source:MGI Symbol;Acc:MGI:1276108]

Alleles

There are 29 alleles of this gene:

Allele Name Consequence Status Availability
sa23063 Essential Splice Site Available for shipment Available now
sa6471 Nonsense Mutation detected in F1 DNA Not yet available
sa23064 Splice Site, Nonsense Available for shipment Available now
sa42920 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23065 Nonsense Available for shipment Available now
sa45603 Nonsense Mutation detected in F1 DNA Not yet available
sa44872 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10215 Essential Splice Site Available for shipment Available now
sa17388 Essential Splice Site Available for shipment Available now
sa23066 Nonsense Available for shipment Available now
sa36396 Nonsense Available for shipment Available now
sa23067 Nonsense Available for shipment Available now
sa36397 Nonsense Mutation detected in F1 DNA Not yet available
sa2916 Nonsense F2 line generated Not yet available
sa13557 Nonsense Available for shipment Available now
sa13763 Nonsense Available for shipment Available now
sa39160 Nonsense Mutation detected in F1 DNA Not yet available
sa45604 Nonsense Mutation detected in F1 DNA Not yet available
sa8438 Nonsense Mutation detected in F1 DNA Not yet available
sa17275 Nonsense Available for shipment Available now
sa36398 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12006 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23063
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 142 4870 2 76
Genomic Location (Zv9):
Chromosome 17 (position 22425705)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22575854
GRCz11 17 22595690
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGTGTCCAAGCCAGAAGACATGGTCCAGCTGGAGCTGCCCGTCACTGAA[G/A]TAAGATACGTGGCATATTGTGCATATTGATTTATTGTGTATAGCATTGCG
Long Flanking Sequence:
CTGTTAAACATCATTTGGGAAATAAAAAAAAATTATTCACAGGAGGGTGATTAATTTTGATTTGAACTTTATATTGTTTTGAATAATCGGGATTACAGTTATGGCCAAAATAATCGTGATTATGATTTTTCCAATAATCGAGCAGCCCTAATGTGTATCCATTTTTCCTTGAAATAGTTATGAGTTGCTGATGTGGCAATAAAAATAAACAAATAAGTTTGATCTGTATGTTTGTTGAACTAATGTAGAAAAGCTTCAGCCTTATGCATTAATGATCACTCAGCCTCTCTCCTTGTGTGTGTGTGTGTTTTGTGACAGCTAAACCTGGAGGCCGGGTGAGGTGTCAGTACTTCCCAGCTGTGGATAAGGTGCTGTTTGTGGACGATTATGCTGTTGGCTGCAGGAAGGACTTGAATGGGATCCTTCTTTTGGACACGGCTCTCCAGGCCCCCGTGTCCAAGCCAGAAGACATGGTCCAGCTGGAGCTGCCCGTCACTGAA[G/A]TAAGATACGTGGCATATTGTGCATATTGATTTATTGTGTATAGCATTGCGATTGCGAGTTGGCTATGCTTTACCTGACCACTAACAGTAAATGGTTGTAGGTTGACCATCTCAGTACAAAGGTGAGCAATGGTGCATTTTAAGCAGCTTGGAATTATTTTCTTGGGTGCTCTTTTGTTTGATAGGATGATAAATATTTATTTCTGTGAAATCCAAGTATGCATTTTTATAATGTTAAATAGGACTAAATGTGTAATTTGAGTCCAGCACTCCAGATGGTCAGTCTGACTTACAGCTGATAAATGTTTTCAGGGCTTTCATGTCACAGCTGGACTGCACATTGTATTTATTGGTAGGGGTGGGAATCGATATTACAGTGGTTCATCGCTATCACTTTTTGTGGCCTCGCAGTTTTACACATTTTTTTTCATACAATTTGACTTTTTTTAATATTTTAATCTTGACTGGCTGTAGACCACTTTCGATCAATCTCCTCCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6471
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 491 4870 10 76
Genomic Location (Zv9):
Chromosome 17 (position 22448495)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22598644
GRCz11 17 22618480
KASP Assay ID:
554-5426.1 (used for ordering genotyping assays)
KASP Sequence:
AGGAGACGATGGAGGTGAGTTTGGGAGTCACAGCTCTCAGTGTTCTACAA[C/T]AGCCTGAGAAATTGCAGTGGGAGGTGGTGGCYAGTGTTCTTGAGGACACA
Long Flanking Sequence:
TTTGAGGTGAACCCGTATGACCCAGCCATCCTTAGGCAGTTGATCCTGTCTGGGAGCGAACAGCAAAATCTCACAGGCACCGAATTACGCAGACCCACACTCTCATGGCTAGAGGAGGCCACATGCTGCTCTGACTTACCCAAACTAGAGGGGGACAGGTTCTAATCCCACATATTCATAATTTTAGTAAGTCATCTTAAGACTATTGTTGTCTTGATTGATTTTTTTTTGTGTGTGTGTATGTGTGTTTTTGTACATAGTGATGACCAGATAGAGGACTCAGACAGTGAAGAGCATTCCAGATCAGAGTCAGTTACAGGTAAAACATTTATTTTCATGTATTAACAATGTTTATTTATTATTTAGCTGCTATGTTTTGTTTTTTTTGTTTTATTAACATCCTACTAATAGATCTCTCCCCTTCTGTATGTGCAGGCCCATTGGGTCAGAAGGAGACGATGGAGGTGAGTTTGGGAGTCACAGCTCTCAGTGTTCTACAA[C/T]AGCCTGAGAAATTGCAGTGGGAGGTGGTGGCTAGTGTTCTTGAGGACACAGTTAAAGACCTGGAGGAGCTGGGGGCCAATCCTCCACATTCACTGGGCCCCCCTAAAGCAGATAAAGCTAAGGATCGGCCAGCTGAACATCACAACATTCCCTTTCCCTGCCTGCTGGCTGGTGGACTGCTAAGCTATCGGTCAGCGGCTAGTTCTCCACTAGGTCCTCCTCCATCTCGCCGCTCCATGGATAGCCCAGTAAGGACTGCTGCCCCTGAGGGGCTTGCGCCAGACCAGGGGCCTATGGAGATTGAGTCCTGTAACCCTTCAACAGACCTGGGCTCCCCAAACTTACCACCAGCCGCCCCTGTGCATAGGACTATGCCTGTACTGCTCCTGTACAGTATCAAGGAAGCAGATGAGAAGTCTTCAGGGAAGGTGTTCACCCAGATGAACAACCTGATGAGCAAAGGGCTTCATGACGAGGGCTTTACCGTCCCACAGATTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23064
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Splice Site, Nonsense 1358 4870 20 76
Genomic Location (Zv9):
Chromosome 17 (position 22456184)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22606333
GRCz11 17 22626169
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTCATTGCTCTTTTTCTAAGAGATGTTATGATCTGTTGTCTTTTAGTT[T/A]GAGAGAGGGGAAAGAGGGGCTTTTGACCAAAACCAGAAGACGTCTGACGG
Long Flanking Sequence:
ATGTAAAGTGTGGTATGTAAACAAACATATGAGTGTTTCTAACAAAATGTCTGGTACATCAGTCTCTATTAGTTTGCTACGAGCGAATGATGTGCACAAAGAACGCCCTGTCCCCTTACCGATATTTACTTACAGTAGAAATACATCAACATATCGAAACAAAAGTCTCAGCAACTTCATCTTCATGCAGACTTTTGTTTAAATCTTTCATTGTCTAAATGTGCTTTCTGTCTCTGCTTGTATTTCCCAGAGTGCAACGCTGTGCAATGCTTCAGTTTCCTGAGCTCCACGAAAAGCTGCTAAGAGGTTTGTGTAAGCGTGGAGAAGACAGCCAGAGCTCTGAACACTGTCAGAGTCTCATATTGGACATCCTCTGCTGGCTGGCTGGAGTTTACTCCAATGGACCGTGCAGGTGGGTCTCTGACTCTGTGTTTTAAGTCTCAGGCTTTTATTTCATTGCTCTTTTTCTAAGAGATGTTATGATCTGTTGTCTTTTAGTT[T/A]GAGAGAGGGGAAAGAGGGGCTTTTGACCAAAACCAGAAGACGTCTGACGGACATTATCAGGGCATGCTTCTTTGAGGCCGGGCGCAGTATAGCTCACAAATGCTCTCGCTTTCTTGCACTTTGTATTAGGTGAGTTTGAATTCTGTGTCTTTTTTTCTGTTCTTCAATTTTGGTGGAGAACTATTATACTAGTAAATATGTTATGGTCATTACGTTTAATGGATGAATGTCTTCTGTTTCAGTACTGGTAAAGGAGACCCTGGTCAGCAGGGTTTTGGCCAGGCACTGTTTAAAGCGCTTTTGGATAATATGCCTTATTTGCCTGCTGCTGCCACAGGAGGTGATTTTTAATTTTCCTATTTTAATTTATTTTGTTACTCTTTACTTTTTTTAACACAACTATTCAAATCATGTCTATGTCTTTAAGGAATTTGGAAATTCAGTGATTTAGTAAAATTTCTTATGTTCACCATTCAATAAATAAATAAAAACCACAGTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28846
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 1573 4870 24 76
Genomic Location (Zv9):
Chromosome 17 (position 22457440)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22607589
GRCz11 17 22627425
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTGCGTCTCCACTAGTGACGGCACTAGAGTGGAGAGGGATGATGCAAG[T/C]ATGTTCACCGGTACATATCCCATTTTTCTCTTTCTCTTATCTTGTTTATA
Long Flanking Sequence:
TCTGACTCCATTGGAAGCGCTGTTGCAAACCAGGTCAGCCAATCTGCTTTAATCCGAGACATACACAAACACATTCTTGTAAACCCATAGAAGTGATTGTTTTTAATAATTGTTTTTTTTTGCAATGGTCACCTCTCTTCAGATACGGTCTGTATGGGTCTCCTTTTGACCCAGTACTGTTTGACCTGGAGGTGAGCGGGTCTTCCTGTAAGAATGCCTTCAGCAGTGGCATCGGGGTCCAGTCGGATGAAATCGACCTATCTGATATTCTCTCAGGTTCGGCAGAACATTCTTCCCCCTTCACACACTTTTATTCATCAATAAACAAAAATTAAACGCATATTTTTTGTGTGTCTATTGTCAGGTAATGGAAAGGTGAACAGTAGCGGGGCGGCAGAGGGCAGTTTCACTGCTCTGACTGGCCTGCTGGAAGTTGAACCTCTGCACTTTACTTGCGTCTCCACTAGTGACGGCACTAGAGTGGAGAGGGATGATGCAAG[T/C]ATGTTCACCGGTACATATCCCATTTTTCTCTTTCTCTTATCTTGTTTATATTACAACCAACCATGTCATCATGGACCGCACGTTTAAGGTATGGTCAAATTAGCTGAGTTGTTTTCTTTGTACTACAAAACCAAACCACAATTCAGCAAATTTGATTCTTTTCTAAGAAGAACCACATCTTTAGTGATAAAATAGTTTCTATACCCCTGTACTATATATTTTGTTTTAGTGAGCACATTTGGAGTGACGCCTACAGTGACAGGGCTGTCTGCTGGGTCTGTTGGCGAAGCCTCCACTGCTCTGAGCTCGGCTGCACAGGTGGCCCTGCAGTCTCTGTCTCACGCCATGGTGTCCGCCGAACAGCAGCTTCAAGTTCTCCAGGAGAAGCAGCAACAGCTTCTAAAACTCCAGCAACAGGTCACATTCTTGCTTAATTGTAATGTTGATTTGTTTTCCATCTAGTTGTGAGTTTATTTAATTGGTTGTATTATGAAACAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42920
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 1635 4870 25 76
Genomic Location (Zv9):
Chromosome 17 (position 22457858)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22608007
GRCz11 17 22627843
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAAGTTCTCCAGGAGAAGCAGCAACAGCTTCTAAAACTCCAGCAACAG[G/A]TCACATTCTTGCTTAATTGTAATGTTGATTTGTTTTCCATCTAGTTGTGA
Long Flanking Sequence:
CTGGCCTGCTGGAAGTTGAACCTCTGCACTTTACTTGCGTCTCCACTAGTGACGGCACTAGAGTGGAGAGGGATGATGCAAGTATGTTCACCGGTACATATCCCATTTTTCTCTTTCTCTTATCTTGTTTATATTACAACCAACCATGTCATCATGGACCGCACGTTTAAGGTATGGTCAAATTAGCTGAGTTGTTTTCTTTGTACTACAAAACCAAACCACAATTCAGCAAATTTGATTCTTTTCTAAGAAGAACCACATCTTTAGTGATAAAATAGTTTCTATACCCCTGTACTATATATTTTGTTTTAGTGAGCACATTTGGAGTGACGCCTACAGTGACAGGGCTGTCTGCTGGGTCTGTTGGCGAAGCCTCCACTGCTCTGAGCTCGGCTGCACAGGTGGCCCTGCAGTCTCTGTCTCACGCCATGGTGTCCGCCGAACAGCAGCTTCAAGTTCTCCAGGAGAAGCAGCAACAGCTTCTAAAACTCCAGCAACAG[G/A]TCACATTCTTGCTTAATTGTAATGTTGATTTGTTTTCCATCTAGTTGTGAGTTTATTTAATTGGTTGTATTATGAAACAGAAGGCCAAGCTGGAGGCCAAACTTCACCAGACCACCTCAGCAGCAGCCACCGCAGCATCAGGCGTTGTCAACTCTGTGCCATCCAACCCGTCCTCAGCCCCAGGCTTTTTTATCCACCCGTCAGACGTCATCCCACCCACCCCTAAAACCACCCCGCTGTTCATGACACCACCTCTCACCCCGCCCAATGAAGCAGTGTCGGCGGCCATTAGTGTGGAACTGGCTCAGCTTTTCCCAGGATCTGTCATTGATCCTCCACCTGTAAACCTTTCAGCACAGAATAAAAACAACCAGAAAGCGAAACCCGTAAGTCCTGAAAAACCACCAGAAAAAATTCCATTATTTATTTGAGTCTTTTTCTAAAAAAATGATTTTTTTTAAGATGTCGGAAGCTATTTTATTTTTGTGTCAAAGTTGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23065
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 1866 4870 29 76
Genomic Location (Zv9):
Chromosome 17 (position 22460646)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22610795
GRCz11 17 22630631
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGATATGGCAGCACTAATGCCCGGGCTAAAATCCCATTGGGTTTTTATTA[T/A]GGCCACACCTACATCCTGCCATGGGAAAGTGAATTGAAGCTGATGCATGA
Long Flanking Sequence:
GGTACCTAATATCAGGTCTTGTTGTCAATTAGCAGTCTGAAGTCAACTGAAGGGCTTCAGAAATTACAAAAATGGCTTCTAATCAATTTACTGTAGATTAAACAAATGTTTTTCACCTGTAGGTGCAAGGCGGTTTGTGACTCTAGATTTTGGCCGGCCGGTGTTGCTCACGGATGCACTGATCCCCACATGTGCAGACTTGGCCTCACTTTCCATTGACATTTGGACTCTTGGGGAGGAAGTGGATGGGAGGAGACTGGTAGTCGCCACAGATATCAGCACACATTCTCTGATTCTGCATGATTTGCTACCCCCTCCTGTCTGCAGATTCATGAAGGTTTATAAATGCTTATTTTAAAAGAGTGTGAACAGGATTCATAGTGGTCTTTTTAAGAAGCAAGTCACTGTCACTAACTCTCTGTGCCCCTCTCCTAGATCACTGTGATTGGTCGATATGGCAGCACTAATGCCCGGGCTAAAATCCCATTGGGTTTTTATTA[T/A]GGCCACACCTACATCCTGCCATGGGAAAGTGAATTGAAGCTGATGCATGATCCTCTGAGGGGAGAAAGCGAAGCTGCCGGTCAACCGGATCTGGATCAACATTTATCAATGATGGTGGCACTGCAGGAAGACATTCAATGCAGGTCAGTGAAACAGCAAATAAGCATAATTAAATGAGCTCCTGCTGCAGAATACAATCATTTCCAGTTTTTTTTCTTCTCCTTTTTTAAAAAAAAATCTGTATTTTTATTCAAGAATATAATACATTTGTCAAAAATGATAGTAAAGAGAGTGTTAATGAAGCAGTTTTACTTTCACATATAAATGTTCTCATCAAATTCAACAATTTTTTTTAATCAATTTGATTATTATTTTCATATGTAATTTACAGAATCACATAAATGCACAAGTAAACAATATTTTTAGCCACTCTTGCACACTCCCCAACCCTTTCTGCACAGACCTCTTAAATGGACCTTAATGCAACATGAAAAATAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45603
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 1991 4870 30 76
Genomic Location (Zv9):
Chromosome 17 (position 22462189)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22612338
GRCz11 17 22632174
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCACCACGCTGTCCAGAGGCTGCGCGTGTCTCTAGGAGCAACTCGAAAA[C/T]AACTGCCTGAAAATTACGACCCCCGAGAGCTGGTTCAGAACTCTTCTACC
Long Flanking Sequence:
TTGCATAAGCAGTACTCCTATGCAAAGGGGCTTTATAAGACGAGACCCAAATGTAACGTTGATGCTCCTCCATCAAGCACATTTATATGGAAAAGCAGCTCATTGGAATAGAAAAACATGCTCTGTGTGCATGCTTCAAATCCAGCCTTTTAAAATCATTAAAATCTTACCAACATGAAAGTTTTTTTTTTTTTTTTTTTGCTTTGTCCTGGAATTTATTTAGCCCATTTAAGCAGAATTGATTCTAATCTAAGTGCTGATCTTTGTGTAGGTATAATTTGGCCTGTCATCGCCTGGAGACGTTACTTCAGAACATCGACCTGCCACCTCTTAACAGTGCTAATAATGCACAGTATTTCTTGCGTAAGCCTGATAAAGCTGTTGAGGAGGACTCCCGCGTCTTCTCCGCTTACCAAGACTGCATTCAGCTCCAGCTGCAGCTCAACCTGGCCCACCACGCTGTCCAGAGGCTGCGCGTGTCTCTAGGAGCAACTCGAAAA[C/T]AACTGCCTGAAAATTACGACCCCCGAGAGCTGGTTCAGAACTCTTCTACCGAGCAGCTCCGAACCATCATCAGATATCTACTGGACACACTGCTCAGCCTGCTGCACTCCTGTAATGGTGAGGGAGACGGTCAAACATCAGCTCGCTGTCAAAACCAATTCAGCTTAATCTAAACCTTGAATGTGAATATTATATTCTTCTCTTTTGCACTCTCAGGCAACTCGGTGCCCTCAGTGTTGCAGAACACATTTCATGCTCAGGCGTGCGAGGAGCTCTTTAAGCAGCTGTGCATCAGTGGGACGCCTAAGATTCGTCTGCATGCGGGTCTGCTGCTGGTGCAGCTGTGTGGAGGAGAGAGGTGGTGGGGCCAGTTCCTGTCCAACGTCCTGCAAGAGCTCTATAACTCTGAGCAGCTGCTCATCTTCCCTCAGGACAGGTAACACTACGCTTTAAAAAAGATTATTGCTGCCTTAATTCTTTGATGCAAATACTCTTTTCTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28847
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 2016 4870 30 76
Genomic Location (Zv9):
Chromosome 17 (position 22462266)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22612415
GRCz11 17 22632251
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCTGGTTCAGAACTCTTCTACCGAGCAGCTCCGAACCATCATCAGATA[T/A]CTACTGGACACACTGCTCAGCCTGCTGCACTCCTGTAATGGTGAGGGAGA
Long Flanking Sequence:
CACATTTATATGGAAAAGCAGCTCATTGGAATAGAAAAACATGCTCTGTGTGCATGCTTCAAATCCAGCCTTTTAAAATCATTAAAATCTTACCAACATGAAAGTTTTTTTTTTTTTTTTTTTGCTTTGTCCTGGAATTTATTTAGCCCATTTAAGCAGAATTGATTCTAATCTAAGTGCTGATCTTTGTGTAGGTATAATTTGGCCTGTCATCGCCTGGAGACGTTACTTCAGAACATCGACCTGCCACCTCTTAACAGTGCTAATAATGCACAGTATTTCTTGCGTAAGCCTGATAAAGCTGTTGAGGAGGACTCCCGCGTCTTCTCCGCTTACCAAGACTGCATTCAGCTCCAGCTGCAGCTCAACCTGGCCCACCACGCTGTCCAGAGGCTGCGCGTGTCTCTAGGAGCAACTCGAAAACAACTGCCTGAAAATTACGACCCCCGAGAGCTGGTTCAGAACTCTTCTACCGAGCAGCTCCGAACCATCATCAGATA[T/A]CTACTGGACACACTGCTCAGCCTGCTGCACTCCTGTAATGGTGAGGGAGACGGTCAAACATCAGCTCGCTGTCAAAACCAATTCAGCTTAATCTAAACCTTGAATGTGAATATTATATTCTTCTCTTTTGCACTCTCAGGCAACTCGGTGCCCTCAGTGTTGCAGAACACATTTCATGCTCAGGCGTGCGAGGAGCTCTTTAAGCAGCTGTGCATCAGTGGGACGCCTAAGATTCGTCTGCATGCGGGTCTGCTGCTGGTGCAGCTGTGTGGAGGAGAGAGGTGGTGGGGCCAGTTCCTGTCCAACGTCCTGCAAGAGCTCTATAACTCTGAGCAGCTGCTCATCTTCCCTCAGGACAGGTAACACTACGCTTTAAAAAAGATTATTGCTGCCTTAATTCTTTGATGCAAATACTCTTTTCTAGTCATCTCTACTTACACTACACTAAGTTTGGGGACAATAGGATTTATAAATGTTTAAAAATATGCCTCTCCTGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44872
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 2103 4870 31 76
Genomic Location (Zv9):
Chromosome 17 (position 22462627)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22612776
GRCz11 17 22632612
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAAGAGCTCTATAACTCTGAGCAGCTGCTCATCTTCCCTCAGGACAGG[T/G]AACACTACGCTTTAAAAAAGATTATTGCTGCCTTAATTCTTTGATGCAAA
Long Flanking Sequence:
AGCTCAACCTGGCCCACCACGCTGTCCAGAGGCTGCGCGTGTCTCTAGGAGCAACTCGAAAACAACTGCCTGAAAATTACGACCCCCGAGAGCTGGTTCAGAACTCTTCTACCGAGCAGCTCCGAACCATCATCAGATATCTACTGGACACACTGCTCAGCCTGCTGCACTCCTGTAATGGTGAGGGAGACGGTCAAACATCAGCTCGCTGTCAAAACCAATTCAGCTTAATCTAAACCTTGAATGTGAATATTATATTCTTCTCTTTTGCACTCTCAGGCAACTCGGTGCCCTCAGTGTTGCAGAACACATTTCATGCTCAGGCGTGCGAGGAGCTCTTTAAGCAGCTGTGCATCAGTGGGACGCCTAAGATTCGTCTGCATGCGGGTCTGCTGCTGGTGCAGCTGTGTGGAGGAGAGAGGTGGTGGGGCCAGTTCCTGTCCAACGTCCTGCAAGAGCTCTATAACTCTGAGCAGCTGCTCATCTTCCCTCAGGACAGG[T/G]AACACTACGCTTTAAAAAAGATTATTGCTGCCTTAATTCTTTGATGCAAATACTCTTTTCTAGTCATCTCTACTTACACTACACTAAGTTTGGGGACAATAGGATTTATAAATGTTTAAAAATATGCCTCTCCTGCTCACACATTATTTAATCAAAAATACAGTACAAATTGTAAAATTGTGAAAAAAGTTATTGCACTATAAATAATTGTTCAAAAGTAGTTTATAATTGAATTGAATTTAATTTAATTAATCGTTTAATTTTCCAATGATTTTAAAGATGAATTTTCAGCTTCATTACTCTAGTCTTCAGATTCACATGATCCTTCAGAAATCACTCTAATATGAATTATTATTATTATTATTATTATTATTATTATTATTATGTTGCTTATTATTATTATTTCTATAATTATTATTGTTAATATTATTAATTGTAATAGTAATAAAAGTAATAATGACTGAAGTAATAATTCCATTTGAAACTAAATACAATAAGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28848
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 2165 4870 33 76
Genomic Location (Zv9):
Chromosome 17 (position 22464141)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22614290
GRCz11 17 22634126
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGGTGTGCTGGATATCCCTATGATCAGCTGGGTGGTTATGCTGGTCTCT[C/T]GATTACTTGACTATGTGGCCAGTGTGGAAGATGAAGCCAGCGCAGCTAAG
Long Flanking Sequence:
TGGTTTTATTGCCAAGTCTGCTTTACACACACACACAAGGAATTTGTTTTTTCTACAAATGTTTCCAGTGTACATAAAGTGACAACATGAAAAAAAAAAAAGAAAAAGATGACAAACATTAGACAAACATAGATAAGGATCAACTTGGCACCAGAGGGCTGCTACTTTTTACAGTGCTTAGCATCACTGCTGGCATCAAAGCTATTAATAAAGATTCTCATGTTTTTCCACCCTTTTCCTCAGAGTATTCATGCTGCTGTCCTGTATTGGCCAAAGATCTCTAAGTAACAGTGGGGTTCTGGAGGGTTTGTTAAACCTTTTAGACACACTGCTATCGCCTCTGCAGCAGGCCGGTGCAGCTCAGCCCCGCAGGACAGAAGGTACGTGTTTGAGAGGGAAGCCTTTTCTGTGTAGGGCTTTTGGGTATGCTACAGGTTTCTGTGTCTTTCGTAGGTGTGCTGGATATCCCTATGATCAGCTGGGTGGTTATGCTGGTCTCT[C/T]GATTACTTGACTATGTGGCCAGTGTGGAAGATGAAGCCAGCGCAGCTAAGAAACCTCTGGGAGCTAAAGACAGGGAAAGATCATTTACAGGTAAGGTTCAGTACACGTTTTAACAATTGATTATGGTTTATACTATTTTTGTGTGTGTCTATGTGTTGTGACATGTATTTTTTGTAACTCTGTCCTATGCTGCCTCTCTAAGTAAGGCAAAAAATAGAAATGAGCAAGTTTGGATATGAAGATATTTGACAAGCATATCTTTTTTTTACTGCTGATATGAAATGTTTCATTGTTGAGAAACTTCCAGAAATTATATTAAGCTTATTTAGTGTTTAAAGAAATGTTCAATCTTATATCCTAAAAGTGTTGTGGTGATTTAAAAAAGAAAAAAAAAAAAGAAAAAAAACTGAATTACTTTTTTTGAAATCTCAAGATTTTGCTGAATAAGACCAGCTTATATATGATAAGAGAAATTTTGGTAACATTTGAAACCTCTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10215
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 2229 4870 34 76
Genomic Location (Zv9):
Chromosome 17 (position 22464941)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22615090
GRCz11 17 22634926
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCGKCTGTATTCAYGCAAGATCCGCAAACAGCTAGWCCATCACAAACAGG[T/C]ACACGTGTCTTGCACAAACCTTTTTATTGTGCTAGGGTTTTTCTATACCR
Long Flanking Sequence:
ACTTCCAGAAATTATATTAAGCTTATTTAGTGTTTAAAGAAATGTTCAATCTTATATCCTAAAAGTGTTGTGGTGATTTAAAAAAGAAAAAAAAAAAAGAAAAAAAACTGAATTACTTTTTTTGAAATCTCAAGATTTTGCTGAATAAGACCAGCTTATATATGATAAGAGAAATTTTGGTAACATTTGAAACCTCTATGCTGTCACTTTTGATCAATTTAATGTGTCCTTAATAAATATATGAATTTATATATTTCAAAAAGTCTTACTAGTAACAAATCTTTGAAAAATTGTATGCATGGTATAGAGAGTTTTTTTTTTTTCTTCTGATGATGCTTACTACACTTTTCTCTTTTCTATGACACCAGGGAACCAGTGGAGTTTTATAAATAACAGTCTGCAGTCTCAGAACCCAAGCAGATCTGCTAAAGGCAGCAACAGCAGTTTAGATCGTCTGTATTCACGCAAGATCCGCAAACAGCTAGTCCATCACAAACAGG[T/C]ACACGTGTCTTGCACAAACCTTTTTATTGTGCTAGGGTTTTTCTATACCGTCACATCAACTTGAAGTCTTTTATTGATATAGAGAGGATGTTAATCAATATTTATTTCATTGCAGCAGTTGAATTTATTGAAAGCCAAACAAAAAGCTTTAGTAGAGCAAATCGAGAAGGAGAAAATTCAGAGCAACAAAGGCTCCTCTTACAAGCTGTTGGTGGAACAGGCCAAACTCAAGCAAGCCACTTCCAAGGTGAGTATCTAGTTATTGGCACTTCATTTTTAAGGCAAGAATTTGTGGCAACAAATATGAAAGAACAAATTCGCAATTATTAACATAGCTTTGAGATGGATCATAATGCTAACCTTGTGGTTATGTGTCTTTGGCAGCACTTTAAAGATCTGATCCGTTTGAGGCGGACAGCCGAATGGCCTCGCTCCACTTTGGACTCTGAAGCGTCAGTGGCAAAAGAGACCCCCGAGGTGGAGCTCCTGCCCTTCACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17388
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 2345 4870 36 76
Genomic Location (Zv9):
Chromosome 17 (position 22465543)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22615692
GRCz11 17 22635528
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCAATGGACTTCACCTGCCACGCAGACCTGCTCCTGTTTGTTTGCAAGG[T/C]GCAAATTRTWTTATGCATYCCTAAGTCGAGGCTGAMATGMAGGGGTGACY
Long Flanking Sequence:
TTATTTCATTGCAGCAGTTGAATTTATTGAAAGCCAAACAAAAAGCTTTAGTAGAGCAAATCGAGAAGGAGAAAATTCAGAGCAACAAAGGCTCCTCTTACAAGCTGTTGGTGGAACAGGCCAAACTCAAGCAAGCCACTTCCAAGGTGAGTATCTAGTTATTGGCACTTCATTTTTAAGGCAAGAATTTGTGGCAACAAATATGAAAGAACAAATTCGCAATTATTAACATAGCTTTGAGATGGATCATAATGCTAACCTTGTGGTTATGTGTCTTTGGCAGCACTTTAAAGATCTGATCCGTTTGAGGCGGACAGCCGAATGGCCTCGCTCCACTTTGGACTCTGAAGCGTCAGTGGCAAAAGAGACCCCCGAGGTGGAGCTCCTGCCCTTCACGCTAGCTCACGAGCGTTGCATCTGTGTGGTCCAGAAACTTGCTCTTTTCCTCCTCTCAATGGACTTCACCTGCCACGCAGACCTGCTCCTGTTTGTTTGCAAGG[T/C]GCAAATTGTATTATGCATCCCTAAGTCGAGGCTGAAATGCAGGGGTGACCGCGCTTTCCCAGTAGCTGGTCCTACATTGTAGAATGCTCTGCCCCTCTGTATTAGATCTATATTATCTCTGTCTGTTTTTAAATCTATGTCGAAAACTTACCTTTTTGATTTGGCATTTTATCAGTGGGAGTTGTTTGTTTTAGCTATAATTTTATACCTTTCTCTTTGTGATTTGTTTTGTGCAGCACATTGGTCAACCTTTGTTTGTTTAATAGTGCTATATAAATAAAATTGACAAATAAAAATATAATATACCGTATTTTCCACACAATAAGACGCAGCGGATTATAGGCTGCAGTTTCAATTCCGGGGTTTATTTCTGTACTTAACCCATACTCAAGGCACACCACATTATAAGGCGCATGCTAAAACTGGCGTTTATTAATTTTTACATAATTTTTTATAATCAATCTGCTCCTACAAATCCATCAAAGTCCTCATCTTATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23066
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 2355 4870 37 76
Genomic Location (Zv9):
Chromosome 17 (position 22467302)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22617451
GRCz11 17 22637287
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGAATGTACTCCAACTACCCAGGTCTTGGCCAGGATAGCAAATGCGACA[C/T]GACCCACGATCCACCTGTGTGAAGTAGTTTCCGAGCAGCAGCTGGAACGG
Long Flanking Sequence:
AGTTTTTTTTTATTATTAATGCTTATTAATCAGAGAGATGCAGCATTAAATATAAAGAATCAGTAATACATCATTGGTTCATTCTATGAGCATATAACAAAATCAATTGACATTTTCTTTCTGTCTGACTCAAACAGTACAATTATAAATGTTAGCATCAAAAGTGATATTTAGCACAGAAACACGAATGATCTAAAACATAATAATAAGATAAATAAAAAGATGCGATACAAATAATTATGCAAGTACAAATCATCTTATTATAAATCTTATTATATCGAAAAATTAAATATAATTTATTTGTATAAAATGTTATTGTTATTCATATATTTTTATAGAATCTGAATGTATATATGTTTGACGGGTTTTGTTTGTTAAAAAAAAAAAAAGAAAATTACAAGCTAAAATATGTAGAAGATTGACCCCCTGTTTTGAACCATTTTTAATGTATCGAATGTACTCCAACTACCCAGGTCTTGGCCAGGATAGCAAATGCGACA[C/T]GACCCACGATCCACCTGTGTGAAGTAGTTTCCGAGCAGCAGCTGGAACGGTTGCTTCTGTTATTGGTGGGGACTGACTTCAACCGCGGGGACATTTCGTGGGGTGGAGCCTGGGCTCAGTACTCCCTCACCTGCATGCTGCAGGATATCCTTGCAGGTTTGTGTTTTAGACCCACGGACAGTCATCCACTCATCATTTATTGATTTGTATTTAGCTGACACTGTATGTGTTTTCAGGAGAGCTGCTGTCTCCGGGGTGTGTGGATGGGATGGAGGGTGCGGGGGCTGATGAGGCCGGGGCCGCCTCTTCCTCTGTAGTGGTGGATTCGGATGACTCTCTCCCTCAGCCGACCCCCATCCCGCTGGTAGAGACCATCGATGAGCCTCTTGGACCTGATATCATCGCAGGTACACCCGGGACATCCTCTGTGTTCCAAAGTGCGTTGGTAACCCCGTCCGAATAGCACATCACCCCACATGGACCCCTTCCCTCACCTGCCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2942
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 2696 4870 43 76
Genomic Location (Zv9):
Chromosome 17 (position 22472029)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22622178
GRCz11 17 22642014
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCTTTCTCTTCAATGCCAGCAGAGTGCCCACAATCCCTCTTAACCAAGG[T/A]CWGACATTCACTGACTTTAANAAAAGTGATAATTTTTTAATTCATCNTTT
Long Flanking Sequence:
TCATTTATTTTAATTTATTTTTATATCATATATTTTTCAAATAATTATTTTTATATTATTTTAAGCTTCATCTAACTAGTGTTGTCCTTTCTACTCATAATATTTTCCCCTCTTATTTCAGTAGCCCAGTCTGCAAACGGAACAGATGACTCTCTTTTGCGTGGGGGCTTCCACAACTCTCCCACCAGCAGTAGTCTAATGGTACAAGCCTCATCCATCCCCATGCTGAGCACCTGCTTCAACAAACTTTTCTCTTTACTGCAAGTGCATCATGTTCAGGTACAGGCACACACTCGTCATGTCTTGTCACCTTTATTTACCTTTGATGTCTTTACACCATATAACTGACTATATTGATCTGTCTCTCTCCAGTTGGAGTCTTTGCTGCAGTTATGGTTGACTTTGAGTTTGAGTTCCTGCTCTGGAGGGTCAGAAGAGAGCGGCTCAGACATCTTTCTCTTCAATGCCAGCAGAGTGCCCACAATCCCTCTTAACCAAGG[T/A]CTGACATTCACTGACTTTAATAAAAGTGATAATTTTTTAATTCATCTTTTTTTCAGTGTTGTTATCTGTATTTTTTAATATATAATGCATGCTTGTTAAGAAACACTTATGATTGTAAATTATAAACAGATTGTTTATTTCCAATGTTGCCAAGTACCTTGCCAATTCTGCTGATATGGCATAAAAAAAGTAAATATATAAATTCTTTTATTAGTATTTTGGTTCTGAGACAACACTACCTGACAAAAGTCTTGTTGTCGATCCCAGTTGTAAGAGCAACTAATAACAATCTTCTAGTTGATCATTTAGAAAAGTGGCAGAAGGTAGTTTATCTGATGAATCATCTATTGAACGGCATCCCAATCGTCACAAATACTGCAGGAGACTTGTTGGAACCCGCATAGACCCAAGATTCTCACAGAAATCAGTTAGTCCAGAATGCATGGCAACATCAACAGCCTGAGATATTGAGACATTTGTGCTGCCCATTACATTACAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6472
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 2911 4870 47 76
Genomic Location (Zv9):
Chromosome 17 (position 22476925)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22627074
GRCz11 17 22646910
KASP Assay ID:
554-5150.1 (used for ordering genotyping assays)
KASP Sequence:
CYAATATCATCCGTCCCGGTGATGCTAAGGCCGTGTGTGGTGAGACCACA[C/T]GAGACCAGCTGATGTTTGACCTCCTGAAGCTGGTCAATGCTTTGGTGATG
Long Flanking Sequence:
ATCTCTGTACAAGTCTAAAATTTAATTCATAATGATCTTAAAAGCATCTTAAAGGTTTAAATTTGATTTGAAGAAACCCGCAGAAACCCTGTAAGCATGTATAAAATCTCCCTTATAGTAATAACATGTGTCCTGTCATGATTTTAAAGGTTTCATGACAGTCTTATGAACACCCTTCAAGTAAAATGAAACCGTATTTTATTTTTACCCTCTTCTCTGTTTGAAGGGGTCCATTCCAGTCCGGTCAGGGTCCTTTAGATGCACAGGTGAAGCTTTTGGAGTTCACCCTGGAACAAAACTTTGAAGTTGTTTCTGTGACCACCATCTTGGCCGTCATCGAATCCATCACCTTCCTGGTTCACCATTACATCACCTGCTCTGATAAGGTGGTCTCACGCAGCGGTTCCGACAGCTCTGTAGGGGCTCGTGCCTGTTTCGGGGGCCTTTTCGCTAATATCATCCGTCCCGGTGATGCTAAGGCCGTGTGTGGTGAGACCACA[C/T]GAGACCAGCTGATGTTTGACCTCCTGAAGCTGGTCAATGCTTTGGTGATGCTGCCTCTGTCAGGTGATAGGGAGTTCAGCGGGAGGCTTCCTCCAGCAGGTGGAGCTACTGACAGCGTGTCGGATGAAGAAAAAGTGTGTGGAAGTAAAGAGTGTGGGGCGGCAGGCACAGCTCAGCATCAGGGACCAGCAGCAGGAGTGGCAGATCTGGTTTTGGCCAATCAGCAAATTATGAGTCAAATCCTGTCAGCTCTGGGGCAGTGCAACAGCAGTGCCATGGCCATGATAATTGGTACATCACTTTAATTTGAAATTAATAAATGTAAAATTATATTATATTATATTATATTACATTATATTATATAACATTATATATGAGGAGATTATGTGTAGTTAATTCTATAAAGTAATTCATTACAAAAACATTAAGCAGCACAACTGTTTTCAAAATTGACAGAAATGTTTTTAACCACCAAATCTAGATCTGCAGATGTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36396
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 2958 4870 47 76
Genomic Location (Zv9):
Chromosome 17 (position 22477066)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22627215
GRCz11 17 22647051
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCAGCAGGTGGAGCTACTGACAGCGTGTCGGATGAAGAAAAAGTGTGT[G/T]GAAGTAAAGAGTGTGGGGCGGCAGGCACAGCTCAGCATCAGGGACCAGCA
Long Flanking Sequence:
TTTTAAAGGTTTCATGACAGTCTTATGAACACCCTTCAAGTAAAATGAAACCGTATTTTATTTTTACCCTCTTCTCTGTTTGAAGGGGTCCATTCCAGTCCGGTCAGGGTCCTTTAGATGCACAGGTGAAGCTTTTGGAGTTCACCCTGGAACAAAACTTTGAAGTTGTTTCTGTGACCACCATCTTGGCCGTCATCGAATCCATCACCTTCCTGGTTCACCATTACATCACCTGCTCTGATAAGGTGGTCTCACGCAGCGGTTCCGACAGCTCTGTAGGGGCTCGTGCCTGTTTCGGGGGCCTTTTCGCTAATATCATCCGTCCCGGTGATGCTAAGGCCGTGTGTGGTGAGACCACACGAGACCAGCTGATGTTTGACCTCCTGAAGCTGGTCAATGCTTTGGTGATGCTGCCTCTGTCAGGTGATAGGGAGTTCAGCGGGAGGCTTCCTCCAGCAGGTGGAGCTACTGACAGCGTGTCGGATGAAGAAAAAGTGTGT[G/T]GAAGTAAAGAGTGTGGGGCGGCAGGCACAGCTCAGCATCAGGGACCAGCAGCAGGAGTGGCAGATCTGGTTTTGGCCAATCAGCAAATTATGAGTCAAATCCTGTCAGCTCTGGGGCAGTGCAACAGCAGTGCCATGGCCATGATAATTGGTACATCACTTTAATTTGAAATTAATAAATGTAAAATTATATTATATTATATTATATTACATTATATTATATAACATTATATATGAGGAGATTATGTGTAGTTAATTCTATAAAGTAATTCATTACAAAAACATTAAGCAGCACAACTGTTTTCAAAATTGACAGAAATGTTTTTAACCACCAAATCTAGATCTGCAGATGTTTTTTTTTTGATTGGTCATTCAATATTGAAAACTAGAGTAATGTCTGTTGACTTTGTTATCAAATAAATATTTTTTATAACGTTTTTAAATATTAATACAAATGATTAAAATTTATTTTGTAATGCTGTACAGTATATTGTATAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23067
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3279 4870 52 76
Genomic Location (Zv9):
Chromosome 17 (position 22480651)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22630800
GRCz11 17 22650636
KASP Assay ID:
2261-0983.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGTTCCAGCTGGTAAAGGCAGAGGTGGCGTCTGCTGTGTGTCTGAGGT[T/A]GCACCGGCCGCGGGACGCTAGCACTCTTGGCCTCTCGCAGATCAAACTAC
Long Flanking Sequence:
CGGTATACATTATTTCAAAATAAATGTAATTGCAATTTTCTCAGCCATACAACTTTTCTATTTTAAAAATAATGCAAACACAATAATAAACATTATTATTATTATTATTCTATTTTTCTTATTCTTAAAATAATAATAAAAATATTAACATCAACAATTGTTTTAAACAGTTTTGAGAGGTTAGATATATACTTAGTCAAATTTTTTATTAAATAATGTTAAGTGCTGGTTTATGGTCTATGGTAGGTCAGAAGAAGAAGGACATTTGTTTTATTCCTCCGCGAAATCTGTCTGTAATGGCTTTTGCCCTGGAATCGGTTAAATTAGTATTTAATGCTACTCTTTCTTTTCCCTAGCATGTCCATCCTCGGTATCTGTGGAGATCAGCGCAGATGGTGTGAACATGCTTCCCTTGTCGACTCCAGTCATCACGAGTGGTCTCACCTACATCAAGTTCCAGCTGGTAAAGGCAGAGGTGGCGTCTGCTGTGTGTCTGAGGT[T/A]GCACCGGCCGCGGGACGCTAGCACTCTTGGCCTCTCGCAGATCAAACTACTGGGCTTGACTGCTTTCGGAAACACTTCCTCTGCCACTGTAAACAATCCATTCCTGCCCTCTGAGGACCAAGTCTCCAAAACCAGGTATCTGTGTTTTACCAATCGGTGTGTTGAGAAGTTTGATTTCTCATTTTAGACCCAAGTGTATAATAATAATTCAAATTTTTTGCCTGTTTTTTTCAGTATTGGCTGGTTACGGTTGCTGCACCATTGCTTGACTCACGTTTCTGATCTGGAGGCCATGATGGCCAGTGCTGCTGCTCCTACAGCAAACCTCCTGCAGACCTGCGCCGCCCTGCTCATGTCTCCATACTGTGGCATGCACTCGCCCAACATTGAGGCTGTGCTGGTGAAGATCGGCCTGCAGTCCACACGCATAGGTCTTAAGCTCATCGACATCTTACTGCGTAACTGTGCGGCTTCTGGAACGGACTTAGCCAGTAAGACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36397
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3524 4870 56 76
Genomic Location (Zv9):
Chromosome 17 (position 22483359)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22633508
GRCz11 17 22653344
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGGCCACCTGAACTATTAATTCTCTTCAATGTCTTGCAGGTTGTTGTA[C/A]AACTGGTCCATGTCTTTGCCCTCTAACATGGTTTTAAAGAAGGCTGTGGA
Long Flanking Sequence:
GTTGGCCCAATCGCTCCGCCCCCTCGGGAATATGGCTTGCTCATGCCCTCCCCATCACACCTGCACTGTGTGGCATCCGTCTTGTGGCACAGTTATGAGCTGCCTGTGGACTACGACTTGCCCGGCCTACTCAACAGAGAGCTTTTTGAGTGAGTCTGCACAGATAAGCACACTCTCTTTTTGCAGTCACGCAGAACAAAATGTTCAAGTAAGAGTTGTGGATGAGTGCTTGTTTATGCCTGAGGTAAGTTTTTAGTGCTCTGCATCTAGAAAAAACGCTGAGGGTGTATATTGAGCTAGTTCTCTTCATCCTCTCTTCAGGTATGAATACTTTATAGGTACAGAGTAGAACAAAGTGAAACAACCTTCGCCATGTACACGGAGCAAATAAAACACCGGCAGCCGTTAATACTAACAGTTCTGAGCATAAGTTAAACATAAGGATGTTTTTTAGGCCACCTGAACTATTAATTCTCTTCAATGTCTTGCAGGTTGTTGTA[C/A]AACTGGTCCATGTCTTTGCCCTCTAACATGGTTTTAAAGAAGGCTGTGGACAGCTTGCTTTGTTCCATGTGCCACATCCACCCCAATTACTTCTCTCTTCTCATGTCCTGGATGGGTATCGTGGCGCCCTCGTCTGCCCAGACCAACGCGCAGCGCCGGATGGCCATGACCGACGACGGCAAGAAGCAGCATGACTTAAACAGCGCCGCCTCCCTCACCGATGACTCCAAACATGCTCGAACACCAGTAACCGTGCCCATCTCCCTCTCAGAGTGCCAGCTGGTGACCCTTGCAGCTGCATCCCAGTCTCCTGGTGCCATTCAGCAGCTGTTAGACTCCGGTCTGCCTTCCTTGCTGGTGCGTAGCTTGGCTGACCTTTGCTGCAACCTGTTGGTCAGCGCGGATCTTCCTTTACCTTCAGGATTCTCCTCACAGACCGAGAGACGGCCGTATTCACATAACCAACACTCACCTTCCTCCACCAACAGGCCGCCTTTGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5631
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3575 4870 56 76
ENSDART00000114100 Nonsense 3575 4870 56 76
Genomic Location (Zv9):
Chromosome 17 (position 22483510)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22633659
GRCz11 17 22653495
KASP Assay ID:
554-3056.1 (used for ordering genotyping assays)
KASP Sequence:
TCATGTCCTGGATGGGTATCGTGGCGCCCTCGTCTGCCCAGACCAAYGCG[C/T]AGCGCCGGATGGCCATGACCGAMGACGGCAAGAAGCAGCATGACTTAAAC
Long Flanking Sequence:
GAGTCTGCACAGATAAGCACACTCTCTTTTTGCAGTCACGCAGAACAAAATGTTCAAGTAAGAGTTGTGGATGAGTGCTTGTTTATGCCTGAGGTAAGTTTTTAGTGCTCTGCATCTAGAAAAAACGCTGAGGGTGTATATTGAGCTAGTTCTCTTCATCCTCTCTTCAGGTATGAATACTTTATAGGTACAGAGTAGAACAAAGTGAAACAACCTTCGCCATGTACACGGAGCAAATAAAACACCGGCAGCCGTTAATACTAACAGTTCTGAGCATAAGTTAAACATAAGGATGTTTTTTAGGCCACCTGAACTATTAATTCTCTTCAATGTCTTGCAGGTTGTTGTACAACTGGTCCATGTCTTTGCCCTCTAACATGGTTTTAAAGAAGGCTGTGGACAGCTTGCTTTGTTCCATGTGCCACATCCACCCCAATTACTTCTCTCTTCTCATGTCCTGGATGGGTATCGTGGCGCCCTCGTCTGCCCAGACCAACGCG[C/T]AGCGCCGGATGGCCATGACCGACGACGGCAAGAAGCAGCATGACTTAAACAGCGCCGCCTCCCTCACCGATGACTCCAAACATGCTCGAACACCAGTAACCGTGCCCATCTCCCTCTCAGAGTGCCAGCTGGTGACCCTTGCAGCTGCATCCCAGTCTCCTGGTGCCATTCAGCAGCTGTTAGACTCCGGTCTGCCTTCCTTGCTGGTGCGTAGCTTGGCTGACCTTTGCTGCAACCTGTTGGTCAGCGCGGATCTTCCTTTACCTTCAGGATTCTCCTCACAGACCGAGAGACGGCCGTATTCACATAACCAACACTCACCTTCCTCCACCAACAGGCCGCCTTTGTCTCCTGAGCTCGCGGCTCCGGTTTTGCGCTTTCTTACAGAAGTAGGAAACAGTCACACCATGAAGGACTGGCTGGGTGGCCCGGAGGTAAACCCGCTCTGGACGGCGCTGTTGTTTCTTCTGTGCCACTCGAGTGCTAGTGGGACTGCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2916
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3575 4870 56 76
ENSDART00000114100 Nonsense 3575 4870 56 76
Genomic Location (Zv9):
Chromosome 17 (position 22483510)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22633659
GRCz11 17 22653495
KASP Assay ID:
554-3056.1 (used for ordering genotyping assays)
KASP Sequence:
TCATGTCCTGGATGGGTATCGTGGCGCCCTCGTCTGCCCAGACCAAYGCG[C/T]AGCGCCGGATGGCCATGACCGAMGACGGCAAGAAGCAGCATGACTTAAAC
Long Flanking Sequence:
GAGTCTGCACAGATAAGCACACTCTCTTTTTGCAGTCACGCAGAACAAAATGTTCAAGTAAGAGTTGTGGATGAGTGCTTGTTTATGCCTGAGGTAAGTTTTTAGTGCTCTGCATCTAGAAAAAACGCTGAGGGTGTATATTGAGCTAGTTCTCTTCATCCTCTCTTCAGGTATGAATACTTTATAGGTACAGAGTAGAACAAAGTGAAACAACCTTCGCCATGTACACGGAGCAAATAAAACACCGGCAGCCGTTAATACTAACAGTTCTGAGCATAAGTTAAACATAAGGATGTTTTTTAGGCCACCTGAACTATTAATTCTCTTCAATGTCTTGCAGGTTGTTGTACAACTGGTCCATGTCTTTGCCCTCTAACATGGTTTTAAAGAAGGCTGTGGACAGCTTGCTTTGTTCCATGTGCCACATCCACCCCAATTACTTCTCTCTTCTCATGTCCTGGATGGGTATCGTGGCGCCCTCGTCTGCCCAGACCAACGCG[C/T]AGCGCCGGATGGCCATGACCGACGACGGCAAGAAGCAGCATGACTTAAACAGCGCCGCCTCCCTCACCGATGACTCCAAACATGCTCGAACACCAGTAACCGTGCCCATCTCCCTCTCAGAGTGCCAGCTGGTGACCCTTGCAGCTGCATCCCAGTCTCCTGGTGCCATTCAGCAGCTGTTAGACTCCGGTCTGCCTTCCTTGCTGGTGCGTAGCTTGGCTGACCTTTGCTGCAACCTGTTGGTCAGCGCGGATCTTCCTTTACCTTCAGGATTCTCCTCACAGACCGAGAGACGGCCGTATTCACATAACCAACACTCACCTTCCTCCACCAACAGGCCGCCTTTGTCTCCTGAGCTCGCGGCTCCGGTTTTGCGCTTTCTTACAGAAGTAGGAAACAGTCACACCATGAAGGACTGGCTGGGTGGCCCGGAGGTAAACCCGCTCTGGACGGCGCTGTTGTTTCTTCTGTGCCACTCGAGTGCTAGTGGGACTGCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13557
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3626 4870 56 76
ENSDART00000114100 Nonsense 3626 4870 56 76
Genomic Location (Zv9):
Chromosome 17 (position 22483663)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22633812
GRCz11 17 22653648
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCCCATCTCCCTCTCAGAGTGCCAGCTGGTGACCCTTGCAGCYGCATCY[C/T]AGTCTCCTGGTGCCATTCAGCAGCTGYTAGACTCCGGTCTGCCTTCCTTG
Long Flanking Sequence:
CTTCATCCTCTCTTCAGGTATGAATACTTTATAGGTACAGAGTAGAACAAAGTGAAACAACCTTCGCCATGTACACGGAGCAAATAAAACACCGGCAGCCGTTAATACTAACAGTTCTGAGCATAAGTTAAACATAAGGATGTTTTTTAGGCCACCTGAACTATTAATTCTCTTCAATGTCTTGCAGGTTGTTGTACAACTGGTCCATGTCTTTGCCCTCTAACATGGTTTTAAAGAAGGCTGTGGACAGCTTGCTTTGTTCCATGTGCCACATCCACCCCAATTACTTCTCTCTTCTCATGTCCTGGATGGGTATCGTGGCGCCCTCGTCTGCCCAGACCAACGCGCAGCGCCGGATGGCCATGACCGACGACGGCAAGAAGCAGCATGACTTAAACAGCGCCGCCTCCCTCACCGATGACTCCAAACATGCTCGAACACCAGTAACCGTGCCCATCTCCCTCTCAGAGTGCCAGCTGGTGACCCTTGCAGCTGCATCC[C/T]AGTCTCCTGGTGCCATTCAGCAGCTGTTAGACTCCGGTCTGCCTTCCTTGCTGGTGCGTAGCTTGGCTGACCTTTGCTGCAACCTGTTGGTCAGCGCGGATCTTCCTTTACCTTCAGGATTCTCCTCACAGACCGAGAGACGGCCGTATTCACATAACCAACACTCACCTTCCTCCACCAACAGGCCGCCTTTGTCTCCTGAGCTCGCGGCTCCGGTTTTGCGCTTTCTTACAGAAGTAGGAAACAGTCACACCATGAAGGACTGGCTGGGTGGCCCGGAGGTAAACCCGCTCTGGACGGCGCTGTTGTTTCTTCTGTGCCACTCGAGTGCTAGTGGGACTGCTAATGCAAACAGCAGCAGCAGCAGTGTTTGTGGGCATGGAGCATCGCCCAGCACTTCACACGCCAGCGCTGCACCTCACACATCAGGTGCGTCATACTCACTGGCGTCATCAAGCCGCAGTAGTGGACTCACCACACAGCAGAGGACCGCCATCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13763
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3626 4870 56 76
ENSDART00000114100 Nonsense 3626 4870 56 76
Genomic Location (Zv9):
Chromosome 17 (position 22483663)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22633812
GRCz11 17 22653648
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCCCATCTCCCTCTCAGAGTGCCAGCTGGTGACCCTTGCAGCYGCATCY[C/T]AGTCTCCTGGTGCCATTCAGCAGCTGYTAGACTCCGGTCTGCCTTCCTTG
Long Flanking Sequence:
CTTCATCCTCTCTTCAGGTATGAATACTTTATAGGTACAGAGTAGAACAAAGTGAAACAACCTTCGCCATGTACACGGAGCAAATAAAACACCGGCAGCCGTTAATACTAACAGTTCTGAGCATAAGTTAAACATAAGGATGTTTTTTAGGCCACCTGAACTATTAATTCTCTTCAATGTCTTGCAGGTTGTTGTACAACTGGTCCATGTCTTTGCCCTCTAACATGGTTTTAAAGAAGGCTGTGGACAGCTTGCTTTGTTCCATGTGCCACATCCACCCCAATTACTTCTCTCTTCTCATGTCCTGGATGGGTATCGTGGCGCCCTCGTCTGCCCAGACCAACGCGCAGCGCCGGATGGCCATGACCGACGACGGCAAGAAGCAGCATGACTTAAACAGCGCCGCCTCCCTCACCGATGACTCCAAACATGCTCGAACACCAGTAACCGTGCCCATCTCCCTCTCAGAGTGCCAGCTGGTGACCCTTGCAGCTGCATCC[C/T]AGTCTCCTGGTGCCATTCAGCAGCTGTTAGACTCCGGTCTGCCTTCCTTGCTGGTGCGTAGCTTGGCTGACCTTTGCTGCAACCTGTTGGTCAGCGCGGATCTTCCTTTACCTTCAGGATTCTCCTCACAGACCGAGAGACGGCCGTATTCACATAACCAACACTCACCTTCCTCCACCAACAGGCCGCCTTTGTCTCCTGAGCTCGCGGCTCCGGTTTTGCGCTTTCTTACAGAAGTAGGAAACAGTCACACCATGAAGGACTGGCTGGGTGGCCCGGAGGTAAACCCGCTCTGGACGGCGCTGTTGTTTCTTCTGTGCCACTCGAGTGCTAGTGGGACTGCTAATGCAAACAGCAGCAGCAGCAGTGTTTGTGGGCATGGAGCATCGCCCAGCACTTCACACGCCAGCGCTGCACCTCACACATCAGGTGCGTCATACTCACTGGCGTCATCAAGCCGCAGTAGTGGACTCACCACACAGCAGAGGACCGCCATCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39160
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3652 4870 56 76
Genomic Location (Zv9):
Chromosome 17 (position 22483743)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22633892
GRCz11 17 22653728
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTCCGGTCTGCCTTCCTTGCTGGTGCGTAGCTTGGCTGACCTTTGCTG[C/A]AACCTGTTGGTCAGCGCGGATCTTCCTTTACCTTCAGGATTCTCCTCACA
Long Flanking Sequence:
CAAATAAAACACCGGCAGCCGTTAATACTAACAGTTCTGAGCATAAGTTAAACATAAGGATGTTTTTTAGGCCACCTGAACTATTAATTCTCTTCAATGTCTTGCAGGTTGTTGTACAACTGGTCCATGTCTTTGCCCTCTAACATGGTTTTAAAGAAGGCTGTGGACAGCTTGCTTTGTTCCATGTGCCACATCCACCCCAATTACTTCTCTCTTCTCATGTCCTGGATGGGTATCGTGGCGCCCTCGTCTGCCCAGACCAACGCGCAGCGCCGGATGGCCATGACCGACGACGGCAAGAAGCAGCATGACTTAAACAGCGCCGCCTCCCTCACCGATGACTCCAAACATGCTCGAACACCAGTAACCGTGCCCATCTCCCTCTCAGAGTGCCAGCTGGTGACCCTTGCAGCTGCATCCCAGTCTCCTGGTGCCATTCAGCAGCTGTTAGACTCCGGTCTGCCTTCCTTGCTGGTGCGTAGCTTGGCTGACCTTTGCTG[C/A]AACCTGTTGGTCAGCGCGGATCTTCCTTTACCTTCAGGATTCTCCTCACAGACCGAGAGACGGCCGTATTCACATAACCAACACTCACCTTCCTCCACCAACAGGCCGCCTTTGTCTCCTGAGCTCGCGGCTCCGGTTTTGCGCTTTCTTACAGAAGTAGGAAACAGTCACACCATGAAGGACTGGCTGGGTGGCCCGGAGGTAAACCCGCTCTGGACGGCGCTGTTGTTTCTTCTGTGCCACTCGAGTGCTAGTGGGACTGCTAATGCAAACAGCAGCAGCAGCAGTGTTTGTGGGCATGGAGCATCGCCCAGCACTTCACACGCCAGCGCTGCACCTCACACATCAGGTGCGTCATACTCACTGGCGTCATCAAGCCGCAGTAGTGGACTCACCACACAGCAGAGGACCGCCATCGAGAATGCCACAGTGGCTTTCTTCCTGCAGTGCATCTCCTGCCATCCAAACAACCAGAGGCTCATGGCACAGGTGTGTTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45604
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3885 4870 59 76
Genomic Location (Zv9):
Chromosome 17 (position 22488276)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22638425
GRCz11 17 22658261
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCGCAAACTGCATCTGCCCATCTCAACTACACTATCAGAAGTATTGGAC[C/T]GAGTCTCAGGTATGGATACACTGCTATTCAAAAGGTTTGGTTAGTAAAGC
Long Flanking Sequence:
AAGGTGTACCAATTAAAAATGGCCTACTGATGTTTTGCTTTTATATTTTTATATAAGGCTATTATTTGTGCATAAGTATATCTAGATAAAGTAATAAACATACAGTTCGTTTGAATAATTTTATAATACCTACTGCTAACTTATGAGTGATATCATCATTAGATGTGGAGGGGGGCCTTAAAATATTTTTATGGGGAAATGGGGGGTCTCAGGCAAAAAAGGTTGGGAACCACTGTATTATGAGACATTAAAAATATCATAATAAGGACACTAAGATATATGTTAAAGTGCAATATCATCCTAATGCAACTTTTTACTGTATAATAGGTTTGCACACTGCTAAGGTGACCCGTCTCTGTTTTTCTTTTTCTCTGCCTCAGCTTTATAAAGGGCGCATTAATGCCACAAGTCATGTGATCCAGCACCCCATGTACGGAGCAGGGCACAAGTTTCGCAAACTGCATCTGCCCATCTCAACTACACTATCAGAAGTATTGGAC[C/T]GAGTCTCAGGTATGGATACACTGCTATTCAAAAGGTTTGGTTAGTAAAGCTTTTATTTTTAAATAAGTTAGCAATTCAGTTGATCAAAAATGACTGTAAAGACATTTATAACATTTATAGACGTTAATATTTGTAAATAAACAATGATTTGATCTTTTATCTTGAAAACAAAAAGGTTTTACACTTATTAATTCACGGTTTTCAGCACTGATAATGTGAATTGTTTCCTGAGTACAAAATCCACACCAATGTTTTTTTTTATATCAAATAAAAACAAATTTATTTGATTTATTAAAAAAATAATTGTAGACAATTGATTTAACATTTTTAGTACCATTGAGATCATTCACATTAGCCATTTAATTCACAAAACATTTTCCCTTGATCAGGTTGAATGAATTTCCATCAGTCATACAGTGAGCTAGTTTTGCATGGAGCCTGCAGTAGTCTATCAGATCTATTAGATTCAGCTTTTGCTACATCTTCAGACTTTCAAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8438
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3900 4870 60 76
Genomic Location (Zv9):
Chromosome 17 (position 22489219)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22639368
GRCz11 17 22659204
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTTAACCCTTTAGATACACCKAGCATCACAGCAAAACTGATCAATGAA[C/T]ARAAGGAGGATAAAGAGAAGAAAAACCATGAGGAAAAGGAAAAGATGAAA
Long Flanking Sequence:
AGTAGTCTATCAGATCTATTAGATTCAGCTTTTGCTACATCTTCAGACTTTCAAGGTCTGATGCACAAAGCATGTAGGGCTAAAACTGTCATGTGGCATGGTCATCAGCATGTGTGTGTGATGAATTGCTTGTCGCTTGAGACCTTGAGTGTGGCAGATATAGTCTTAGTTTCCTCTGAAGACTTCAAGATACATCGTACATAAGGTGTCCTGTCTCGGAGCTGTTCTCGTGCTTGCATCACTTCCATAGATGGAAGACCCTCATAGGAAGCACAGCAGGTCGTTATCGTTATGGATTGCTGTTTCTTCATGGGCATATTACATCTTTACTTTCAGATATTCAGATTATCAGTTAAAATGACATGTTGTTCGTTGCATATGTCTCTAAAGGGAAATGTATTTTTCGAGCCTGCAGGCTGACTGCACACATACTGTGAGATAACTTGGTATTTTTTAACCCTTTAGATACACCGAGCATCACAGCAAAACTGATCAATGAA[C/T]AGAAGGAGGATAAAGAGAAGAAAAACCATGAGGAAAAGGAAAAGATGAAAGCTGATAACGGTTTCCAAGACAACTACAGTGTCGTTGTTGCCTCAGGTACTGTTTAACCCTGCATTGAATCACTGAAAATCACCCTGCATTGCATCACTGAAAGTTTCCTATCACTGCATGCCGTTAACAAGAATATGGAAAAATACTAACAGCCTACTAGTGCAACCATCTAACAACCATCAACGAACTACCTAAAAAAAACTCAAGCATTATAACACTGTGCCAGCCACCTGAAACATCTTAGCAACCAGATAACAACCAACAAGATTCCGCTTTCATCGTCTTACAGCAACCCTTGCCACCTATAAAAAACCCAAAACAAATGAACCCAAAATTCATTTAGAGATATCTCTAATTACAATTGTGACTAGTCAAAACTCATTTAGAGATATCTGCAAATATTTTTCAATGGAAGTCAATGGAGGAATATGACTAGTCATAATATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17275
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 4047 4870 63 76
Genomic Location (Zv9):
Chromosome 17 (position 22498986)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22649135
GRCz11 17 22668971
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAGATTGAATGATGCATTTCTGGGCTTCTTTCGTCCTGTAGATCACTGC[G/T]AGATGCTAAGCGGCTGTCCTGACGATGAACCGATGACCCCRGGTGACGAG
Long Flanking Sequence:
TACAGATTATACACGTACAAACAAGTAAAATGGGGAAAAGTCTTGATTAAATCCAAACACACAGGGTGGAAACTGACACATCTCAGCTCACCATTTGTGATCAGATCTTCAAAAGAGCATATTAATACCAGATGTGAATAGGGCCGTTATGTCAGCTGTAAACTCTATAAATCTGCTCCGTGTTTATATTAGAGCACTGTTGTTTCATTACAATTCTGACTGTGCATTCAGAAACACTTAACAGCCAATATCTCCTGCAACTTTCTCCTTATTCCCTCACATCGATCCTCAATCTCAGCAAATGAAAACCTGATTTAGAGGAATAATCTGATTTATGAGAACAGAAATGAGCTCTTGTGCAGTACTGCCCTGCTTTGGACATCGTGGTTTATGATGGGAACAATTGAGACCACTTTATTTACAGCTAGACGTTATGAGATTTTATTGACGCCAGATTGAATGATGCATTTCTGGGCTTCTTTCGTCCTGTAGATCACTGC[G/T]AGATGCTAAGCGGCTGTCCTGACGATGAACCGATGACCCCGGGTGACGAGGGTTTGGATGCTGCGGTGGATGACAGCCTCCTGGAGACCAGTCCTATCCAGTCTCCTTTGCAGGTGTTCGCCGGTATGGGCGGCTTGGCGCTGATCGCGGAGAGACTTCCAATGCTGTACCCCGATGTCATCCAGCAGGTCAGTATATCTGCAAGCTTGCTCTCTGTGCAAAATTATATTCTACCGCGTAGGTAATTTTATGTAGTTTCACTTCATTTCTGCTTCATAAGCCACTCGTTCGCTGACCGTAACCTGAGGTTAGTCAGCATTTCTGTTCATTTGCGTGTCCTCTGAGCCAGTTCGTCCGGATCGTTCTGTGCAGGTCAGTGCCCCAGTGGTGCCATCCACCACACAGGAGAAACCCAAGGACAGCGACCAGTTCGAGTGGGTCACTATTGAACAATCCGGAGAGCTTGTTTATGAGGCGCCCGAGACTATTGCGGCCGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36398
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 4282 4870 65 76
Genomic Location (Zv9):
Chromosome 17 (position 22503508)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22653657
GRCz11 17 22673493
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGCCATCATGCTCCCAGAGTGCCCAGCGGCAGTGCCAACTCCAGTGAG[G/A]TCAGTGTTAACCCGCACGCTGTTTACCTGTCATTCAGCCCACAAAAATCA
Long Flanking Sequence:
AAATCAAGTTTTTATATAGCACTTTTCTCCAATTATATTATAATCAAGTTCAGAAAAGTTAAGCTTATTAGTTACCTTAATGTTATTAGTTACTAATAACTTTAACTAATTAACTGTTTAGTCAGTGAAACCAAAATAAACTCTTTTTAGGAAACGAAAAGTCAGTGTTTTTGACATTTGTCTTAGAGCAGGAACCCTGGGTTTTTCTTGCTCTAAATGTTAAAGACATTCTCATCTAGAAAGACAATTTCTCATTCTATTCATCTGTCATTCTTCCTCAAGGTCACATCCTACAGTCTCCCTCTGCTAACGTTCTACCCACGTTGCCCTTCCACGTGCTTCGCTCCTTGTTCAGTTCTACTCCCCTCACCACGGATGATGGGCTGCTGCTGAGACGCATGGCACTGGAGATCGGTGCCATCCACCTCATCCTGGCCTGCCTGTCTGCCCTCAGCCATCATGCTCCCAGAGTGCCCAGCGGCAGTGCCAACTCCAGTGAG[G/A]TCAGTGTTAACCCGCACGCTGTTTACCTGTCATTCAGCCCACAAAAATCAGCATGTTCGTGACAGCAATGAAAACATTAGCATGTGAACTTGCATGTTAAAACACTCAGTGTTTAGCAAACCAAATAATGACTGAATTCACAGAGTTTGGAGAAGTTTGGAAGGAAAATTATTTGCATATATTTTAAAATGTATTCCTGTGTTGGCAGAGCTGAATTTTTAGCAGCCATTACTAAAAGGAAACAAACAGTAACAAACTGTATCTTGTTATCTTGTATTCAGAGCGAGTTGTCTGTTATTTGGAAAAAAAAATTATGTAAAGCTAAATTATTTTATAAAGACTGACCTGAGTAGTTTGCAGAGTTATTAAAAGAGCATTACAGATGGTGTGAAATGAGATCAGTCCACTAGTAAGTCTTGTTATCTAATGGGGTATATGCACATAGTCAGCCAGCCCAACAACTTCCGATAAACTGTCTTCCCATTACAAAACCGCCCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12006
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 4393 4870 67 76
Genomic Location (Zv9):
Chromosome 17 (position 22509489)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22659638
GRCz11 17 22679474
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGTCCTGTCTAATCCCTGCCATGWCTTCATACTTGCGCAATGACTCAGG[T/C]AAGACACGTGTCACATGTGAAATGYATTCAGTGCTTGACTTCTTGCAGAA
Long Flanking Sequence:
TGGTCCGTTTCACACAACTTGATCTTAGTACTGCTTGTGAACAGCATCCACATTGCCAAATCTACAGCTTAGTTTGTGTTTGTGCTGCAGCCGCAGGTCTCCAGTGGGCATGTTGGTGGTACCACAGAGGAACAGCAGCTGTATTGGGCCAAAGGAACAGGCTTTGGGACTGGCTCAACAGCATCAGGCTGGGATGTAGAGCAGGCTCTGACCAAACAACGCCTGGAGGAAGAGCACGTCACCTGCCTCTTACAGGTGTGTGTCTGTTAAAATATATCAATTAAGGTTAAAATTTGCACATGCTTGAATGTGTGATGATATGTTCTGTGTCAGGTTTTGGCAAGCTATATCAACCCATCAGGCTGCGTGGGATCTGGTGAGACCCTCACAGGAGAGGTCAGAGGTCACAGCAGCTCACTGCTGCCATCTGTCCTGCAGGAACTGCTCAGCCAGTCCTGTCTAATCCCTGCCATGTCTTCATACTTGCGCAATGACTCAGG[T/C]AAGACACGTGTCACATGTGAAATGTATTCAGTGCTTGACTTCTTGCAGAACTGCACTTACAAGGTGGCTTAGGAAGATTTCTACATGGCGCTTTAAATTTGTGGTTTTGTCTTTGGAGAAATGTGTTTTTCATCTCTGGTTTGTAGCTATGTCTGTGCAATGTTAGCATCATGGTGTTATGTGTGTTAGTGTTATTATTATGAAGAACCCTTTTCTAGTTTTAACTTTGTATCTAAAGTTTGTATCTCAGTTAATATGAACTCATAAAACTCAGTACTTCCATTGTAATTAGAGCCATGAACAAACACTGCTTTGTTGGTTTAGGGAGCCAGACATTGGTGTGTGTCTGTTGTGCATTCAATGTGTGTGTGTGTGTGTGTGTGTACACACTGTGAGTGTTTATTTCTCTCCGGCTTAATTAAATAAGCGCAGATAAAACGATGAGTGTAGTAATTAGCTCTAGATATCAGCTGGAGGTTTCAACCCTACATTGGCATGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2947
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 4644 4870 72 76
Genomic Location (Zv9):
Chromosome 17 (position 22558449)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22708598
GRCz11 17 22728434
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGCCTGCGGACACACCATATGCCAATGGCTGTTTTGAATTTGATGTCTA[T/A]TTTCCTCAAGACTATCCCAACTCCCCTCCTCTGGTWAATCTGGAGACCAC
Long Flanking Sequence:
CCTGTCAGAAAAGTCTAGTGGCTGGGAATTACCTTTTTACAGTGTCTGTTATATTGTTAATGTTGTTTTTTGTGTTTACATTGATGGATATGGCCAACACAGTACAGTTACAATCTTTTTGCCACATTAAATCATTATGATAACATAATATATGCCTTCAGTGATTGCTTGAAGATAAATACCAAAAAATAACTCAACTGGAATAACTACAGCAGTCGTCATCATCTGATCTCATATGAAGATGACATATGTCAATTTTTGCACCCTTTTTTTCCACACTCAGTTTCAAGAGCCAAGGGGAAGGGGTACAAAAATAGAATTGGGATTGGGCCTCTGTTTTTGTATCTGAACCATGCACTCCCTAGGTGACTGTATAGTTATGCTTTAGAGATGGACACTCATTCCTGTGCTGTTCAATGTGTTTTTTTTTTCTCTCAGGTGTTGATAACGGGGCCTGCGGACACACCATATGCCAATGGCTGTTTTGAATTTGATGTCTA[T/A]TTTCCTCAAGACTATCCCAACTCCCCTCCTCTGGTAAATCTGGAGACCACCGGTGGCCACAGTGTCCGCTTCAACCCAAACCTCTACAATGATGGCAAGGTAAGGGTCTCTTCTTGTTGGCTCCTTGTTTGTTTGTTTTTGTGGCAATACAGATGCTAATAACTAGACAGTAGGTTGTTAGTATATGATTAATATTATTATATTTTATTTATAAAATTTTATTTGTGCAGATTGTTCATTTTAGTTTTAATTATGTGCTAATAATGTAACATATGGGCAAACATTGGCGCAATGTAAAATCTAAAATTGTGTCATATTTTGTTATTTTTTATTTTCTGATATTTTATTAAATTAATATTATATATTTTTTAAAATATTTAATTTATTTTACAGCCTGTCGTAACTTTAAGTAACTGTTGTACTTTTCTTTAGACTTTTTTTGTTAAAATGTTTGTATACTTTTTGTTTTACTTTGAAACTTTTTATCAATTTAACTTGTA
Associated Phenotype:
Not determined