Busch Lab

ZMP

zgc:162879

Ensembl ID:
ENSDARG00000074163
ZFIN ID:
ZDB-GENE-070424-92
Description:
Ras and EF-hand domain-containing protein [Source:UniProtKB/Swiss-Prot;Acc:A5WW21]
Human Orthologue:
RASEF
Human Description:
RAS and EF-hand domain containing [Source:HGNC Symbol;Acc:26464]
Mouse Orthologue:
Rasef
Mouse Description:
RAS and EF hand domain containing Gene [Source:MGI Symbol;Acc:MGI:2448565]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4752
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103046 Essential Splice Site 501 663 None 17

The following transcripts of ENSDARG00000074163 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 25543854)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 25773627
GRCz11 18 25760159
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGAGGTTGAGTCTTAATGAATTCAGAGGGGATATACAAACCACTCTTGG[T/C]GAGAAGATGCAACAATGCCATTTTTTNNNNNNNNTCTTAAGTGTGTTAATGTTACC
Long Flanking Sequence:
ACCTCTAACAAACAGCAATGGAACAAGCAATAGCAAACGGCTTACAATGATGGAGATTGGTTCAAGGATGACTGCCACTGGACATGACTCAATTGATGGACGTTATTTTTGCTTCACATGTATGGCTGATATTTTCAGTCACTAAATGATTTTGTTTAGCTCTTTCCCTGCAGTTAAAGATCATGCCTTAACTAAAATGGCAAAAAAGGTTTTCTAAGGCAAAATGTTAATGTTAAAACAAAGCAATTGGCATCCTACAAATCATATAAAATTGATAGATGTAAAGATTTGACATTTTGAAAGCATACTGTAGATGTCCATTAACCTGATTAATCATACAACTGTTCTCTGTAGCAAAATGAGGAAGATTTACTTGACACACAAGATCTGGCTCCAGTGTACCGTTTGGTGTTGGCTGGAGATGCCGGGTCAGGAAAATCCAGCTTTTTACTGAGGTTGAGTCTTAATGAATTCAGAGGGGATATACAAACCACTCTTGG[T/C]GAGAAGATGCAACAATGCCATTTTTTTTTCTTAAGTGTGTTAATGTTACCATATGAATACAGTGTGATAATGGAGAATCTTGCAGGTGTTGATTTTCAAATTAAGAAGATGCTTGTAGATGGAGAGAAAACAAACCTTCAGATCTGGGACACTGCTGGACAGGAAAGGTACAGTGTGCTTTATGTAATAACCAATTGTAGGCATGGGCTAGTATTAAATTCTGATGGTATGATAACCTTGCATAAAAATATTACAGTTTCATGGTATTGTTTACTGCTCTAAAATATATTTTTTAAAATGTCTGGGTAAAAAAAGATAACTTTCCCTTTTGAACACAATATATTTTATTTGAGAAACATTTAAACTATGTTGTTACAGTCAACATGTCAGGCTAAATAATGAAAATTAATCATTGACTTCTGCTGTCTTCATTTAGTTTCAAAATCAGATTTTTATTTATTTATTTTTTAAACGGCATACTTTAGATATTTTCTGCTGAA
Associated Phenotype:
Not determined