Busch Lab

ZMP

TNRC6B (1 of 3)

Ensembl ID:
ENSDARG00000074161
Description:
trinucleotide repeat containing 6B [Source:HGNC Symbol;Acc:29190]
Human Orthologue:
TNRC6B
Human Description:
trinucleotide repeat containing 6B [Source:HGNC Symbol;Acc:29190]
Mouse Orthologue:
Tnrc6b
Mouse Description:
trinucleotide repeat containing 6b Gene [Source:MGI Symbol;Acc:MGI:2443730]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa2628 Essential Splice Site F2 line generated Not yet available
sa42013 Nonsense Mutation detected in F1 DNA Not yet available
sa35263 Splice Site, Nonsense Available for shipment Available now
sa7358 Missense Mutation detected in F1 DNA Not yet available
sa35264 Nonsense Mutation detected in F1 DNA Not yet available
sa22079 Nonsense Available for shipment Available now
sa45458 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11065 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2628
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114402 Essential Splice Site 31 1736 2 27
Genomic Location (Zv9):
Chromosome 12 (position 20379722)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19161566
GRCz11 12 19283440
KASP Assay ID:
554-2537.1 (used for ordering genotyping assays)
KASP Sequence:
AATTAAAATATATGTTTTCATCAAATTTGTATCTCCTTTTTTATTGTTTT[A/C]GGTTGCAGAGCAAAAAAATAAAGGTAACTATTTTATTTCCATCTTTAATT
Long Flanking Sequence:
ATCACTTAATTAGCATTCATGCTTTAGGTTTGATCTCAATATAATCTTGCTTACCATATCTAAATCCTTAAAAAGAATGTGTAAGATATAGTTGAGATGTTTGTTTTGAGCCAGCTTGTCCTGTCAGATACTCTGACATATATGTGCTAAAGACAAATAGGTTATGTTGGCTGTTTAATTAGTTTTTTTTTCTCATTGCAAAACCTATATATATCACATGTTATAAAAATATTTCCATTTTGCTGTCAGGGGCGCAAGAGGGTTTCTGCATGTGAATTTCCTCTCAGCTTCACTGAACAATTGTGAAGTTTTGTGATGGAGTTATAATGGTCATTAAAGTTTTATTGTTCTTAGTGGGAAAGGCTACTTTAAATAATTTTATAAAATGCGGTGGAATGTAGTTAAGAGATGAAGAAGGAATACCTTAAACTTTGTTGTGTGCCTTGAGTAAATTAAAATATATGTTTTCATCAAATTTGTATCTCCTTTTTTATTGTTTT[A/C]GGTTGCAGAGCAAAAAAATAAAGGTAACTATTTTATTTCCATCTTTAATTTTTGAACTCTGTACCGACGTTCTGAGACGATGTGTTTTTATGCTGTCAAGGAGGCATATTATGTAATGTCCACTTTGTTAACTTGTGAATTTATTCTTTTCTTTTACCTATATGTAGCTTTTCTGCAGTTCTGCTCTCATTTGCTCCTAACTTTTCCACCACACAGTGCCAGAATTGACCAAGCCTCCATCTGCACAGTCTCCTGCCGCCCCCAACTCAGCTTCCCCCAGCCCTGGCCCCGTCCCCTCTTCAACCCCATCCGCTGCCACCCCGGCTGCTGGCACCCTCCCTCAGGGTGGGAACAATGCTAAGCGGCCGGCGGTGGCCAACGGACAGCCCTCCCCCAGCACACCGAATTCTCAGCGCTACATGCCCCGTGAAGTGCCCCCTCGATTCCGTTGCCAGCAGGACCATAAAGTGCTACTGAAGAGGGGCCAGCCACCACTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42013
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114402 Nonsense 78 1736 4 27
Genomic Location (Zv9):
Chromosome 12 (position 20380106)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19161950
GRCz11 12 19283824
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTCCCTCAGGGTGGGAACAATGCTAAGCGGCCGGCGGTGGCCAACGGA[C/T]AGCCCTCCCCCAGCACACCGAATTCTCAGCGCTACATGCCCCGTGAAGTG
Long Flanking Sequence:
AATGCGGTGGAATGTAGTTAAGAGATGAAGAAGGAATACCTTAAACTTTGTTGTGTGCCTTGAGTAAATTAAAATATATGTTTTCATCAAATTTGTATCTCCTTTTTTATTGTTTTAGGTTGCAGAGCAAAAAAATAAAGGTAACTATTTTATTTCCATCTTTAATTTTTGAACTCTGTACCGACGTTCTGAGACGATGTGTTTTTATGCTGTCAAGGAGGCATATTATGTAATGTCCACTTTGTTAACTTGTGAATTTATTCTTTTCTTTTACCTATATGTAGCTTTTCTGCAGTTCTGCTCTCATTTGCTCCTAACTTTTCCACCACACAGTGCCAGAATTGACCAAGCCTCCATCTGCACAGTCTCCTGCCGCCCCCAACTCAGCTTCCCCCAGCCCTGGCCCCGTCCCCTCTTCAACCCCATCCGCTGCCACCCCGGCTGCTGGCACCCTCCCTCAGGGTGGGAACAATGCTAAGCGGCCGGCGGTGGCCAACGGA[C/T]AGCCCTCCCCCAGCACACCGAATTCTCAGCGCTACATGCCCCGTGAAGTGCCCCCTCGATTCCGTTGCCAGCAGGACCATAAAGTGCTACTGAAGAGGGGCCAGCCACCACTGTCCTCCATGCTGCTGGGGGGAGGCAACAGCGGGGGAGACAGCCCCAATGAAACAGTGGCTTCTGCCTCAGGTAGGAATCATTAGGTTAATAATTTAAATTGCATAGTTACATTTTTATTCAGTTTTACACTGGGTAAGTTGATCATTATATTTTATAGTTTGTATTACATATGCTTGGTTTTTGTGTCATAAAAAAGTCTAGCATATCTTGAAGATTTTATTTTATTTCAGATCCAAGCCAGGGCCCTGTGGGTCCAGCTGCTCCCTCACTGCCCCATACGTCATCCGCCTCATCAATCGCTGCTTCTTCTTCTTCAAATTATGCAAATTCCATGTGGGGGACCAGCTCTGGCAGCCATCCCCTCTCTCAGGGCAGGGAAAAGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35263
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114402 Splice Site, Nonsense 138 1736 4 27
Genomic Location (Zv9):
Chromosome 12 (position 20380287)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19162131
GRCz11 12 19284005
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGAGGCAACAGCGGGGGAGACAGCCCCAATGAAACAGTGGCTTCTGCCT[C/A]AGGTAGGAATCATTAGGTTAATAATTTAAATTGCATAGTTACATTTTTAT
Long Flanking Sequence:
CGACGTTCTGAGACGATGTGTTTTTATGCTGTCAAGGAGGCATATTATGTAATGTCCACTTTGTTAACTTGTGAATTTATTCTTTTCTTTTACCTATATGTAGCTTTTCTGCAGTTCTGCTCTCATTTGCTCCTAACTTTTCCACCACACAGTGCCAGAATTGACCAAGCCTCCATCTGCACAGTCTCCTGCCGCCCCCAACTCAGCTTCCCCCAGCCCTGGCCCCGTCCCCTCTTCAACCCCATCCGCTGCCACCCCGGCTGCTGGCACCCTCCCTCAGGGTGGGAACAATGCTAAGCGGCCGGCGGTGGCCAACGGACAGCCCTCCCCCAGCACACCGAATTCTCAGCGCTACATGCCCCGTGAAGTGCCCCCTCGATTCCGTTGCCAGCAGGACCATAAAGTGCTACTGAAGAGGGGCCAGCCACCACTGTCCTCCATGCTGCTGGGGGGAGGCAACAGCGGGGGAGACAGCCCCAATGAAACAGTGGCTTCTGCCT[C/A]AGGTAGGAATCATTAGGTTAATAATTTAAATTGCATAGTTACATTTTTATTCAGTTTTACACTGGGTAAGTTGATCATTATATTTTATAGTTTGTATTACATATGCTTGGTTTTTGTGTCATAAAAAAGTCTAGCATATCTTGAAGATTTTATTTTATTTCAGATCCAAGCCAGGGCCCTGTGGGTCCAGCTGCTCCCTCACTGCCCCATACGTCATCCGCCTCATCAATCGCTGCTTCTTCTTCTTCAAATTATGCAAATTCCATGTGGGGGACCAGCTCTGGCAGCCATCCCCTCTCTCAGGGCAGGGAAAAGGTGATAGTGGACCGGTCAGACCTGGAGGAATGGCCCAGTATTGCTGCTGGGGATGGATCAAAGTCAGGGGATGCAGCAGGTACAGGAGGTACAGACAGTGGTGCGATTCTGAACTGCAATGCCTCGTGGGGTGAGAGGCATCTCCAGCAGCAAGCGAAAGTTGTGGGAGGAGGGAATGGAAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7358
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114402 Missense 306 1736 6 27
Genomic Location (Zv9):
Chromosome 12 (position 20381036)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19162880
GRCz11 12 19284754
KASP Assay ID:
554-4316.1 (used for ordering genotyping assays)
KASP Sequence:
GATTCCAGGTGCCAATTTTACCCCTAATGCCAATCCCTCTGCTTGGCCAG[C/T]CCKAGTACAGGAAGGGGCTGGGACAGTTGCAACAGAGGGTGGCTCCTCTT
Long Flanking Sequence:
AAATTATGCAAATTCCATGTGGGGGACCAGCTCTGGCAGCCATCCCCTCTCTCAGGGCAGGGAAAAGGTGATAGTGGACCGGTCAGACCTGGAGGAATGGCCCAGTATTGCTGCTGGGGATGGATCAAAGTCAGGGGATGCAGCAGGTACAGGAGGTACAGACAGTGGTGCGATTCTGAACTGCAATGCCTCGTGGGGTGAGAGGCATCTCCAGCAGCAAGCGAAAGTTGTGGGAGGAGGGAATGGAAGGAAAGGAGTCAATTCTGGCAGTTCCTCTCCGCCCACATCCTCTGGATCACCCAATGAATGTATGCAGTCTGGTAGTGTTTGGGCTTCATCCTCCCATGAACTCATAGGGGGGAATGCAGTAGCAGCAGGCTCATTGCCCCCCATATCCAAAGCTGCCCCTCTCCCAGGGAGCTCTGATAGCTCCTTTGGTGTCAGCTGTGGGATTCCAGGTGCCAATTTTACCCCTAATGCCAATCCCTCTGCTTGGCCAG[C/T]CCTAGTACAGGAAGGGGCTGGGACAGTTGCAACAGAGGGTGGCTCCTCTTCCCTCCAAAGCTCATCTTTGTCTGCCAGCAACCCTCTTTCTGTGAATCAAGCCTCTCATCAGCACCAACTTCACCAAATGCAATCCAGAGACAGAGAGCCATCCTGTGGAGAATGGGGTGGCACAGCACTGGAACCAGGAGCAGGACCAAAAAACACTGGGGTGACAGAGGGGGCTGATATGGACTCTGGAAGCACAGGTGGAGGAGCAGGCTCTGCTTCGTCTTCCTCCTCCACCAGCTCATCATTGTGGAGAACTCAGCCTTTCCCTGCAAACTTCAAAACGGGTGCCTCAAGGACTGAATCTTGGGATGATGGAGCAGGAGGGAGCTCCTTGTCTGCTGAAAGTGGGAAGGCATGGGGATATCCCGGCCAGGACGATCGAGGAGATTTGACGGGGGCAGGTGCCTGGGGAACAGGAAGTGGGGGTCAGACCCCCGGGGTATCTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35264
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114402 Nonsense 409 1736 6 27
Genomic Location (Zv9):
Chromosome 12 (position 20381344)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19163188
GRCz11 12 19285062
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGCTCTGCTTCGTCTTCCTCCTCCACCAGCTCATCATTGTGGAGAACT[C/T]AGCCTTTCCCTGCAAACTTCAAAACGGGTGCCTCAAGGACTGAATCTTGG
Long Flanking Sequence:
GTATGCAGTCTGGTAGTGTTTGGGCTTCATCCTCCCATGAACTCATAGGGGGGAATGCAGTAGCAGCAGGCTCATTGCCCCCCATATCCAAAGCTGCCCCTCTCCCAGGGAGCTCTGATAGCTCCTTTGGTGTCAGCTGTGGGATTCCAGGTGCCAATTTTACCCCTAATGCCAATCCCTCTGCTTGGCCAGCCCTAGTACAGGAAGGGGCTGGGACAGTTGCAACAGAGGGTGGCTCCTCTTCCCTCCAAAGCTCATCTTTGTCTGCCAGCAACCCTCTTTCTGTGAATCAAGCCTCTCATCAGCACCAACTTCACCAAATGCAATCCAGAGACAGAGAGCCATCCTGTGGAGAATGGGGTGGCACAGCACTGGAACCAGGAGCAGGACCAAAAAACACTGGGGTGACAGAGGGGGCTGATATGGACTCTGGAAGCACAGGTGGAGGAGCAGGCTCTGCTTCGTCTTCCTCCTCCACCAGCTCATCATTGTGGAGAACT[C/T]AGCCTTTCCCTGCAAACTTCAAAACGGGTGCCTCAAGGACTGAATCTTGGGATGATGGAGCAGGAGGGAGCTCCTTGTCTGCTGAAAGTGGGAAGGCATGGGGATATCCCGGCCAGGACGATCGAGGAGATTTGACGGGGGCAGGTGCCTGGGGAACAGGAAGTGGGGGTCAGACCCCCGGGGTATCTCAGGGAGCGTGGGGTGGGGACCATTTGTTGGGTGGGGAATGGGGGGCATCCAGTGGTGTTGGAGGTGTCAGTGATCAAGGTGGGAAAGACGGCTCAAGCAGTAACAGCAGCAGTAGTGGCGGTAGTGTCAGCATCCCGACGACAACCTCCTCCACACCTTCAACTATGACAAGAGCTTGGGACAATCAGAAAGCAGTTGGGGATGTGGGAGCAGGAGATTTGAGTGAGTGGGGAGGCCAGGGTAGCAGAGGTGGGGAAGGTACCTCATCCTCCAGTGGTGGAGGAAACTCCAGAAGTGGCAATCAGCGCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22079
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114402 Nonsense 789 1736 8 27
Genomic Location (Zv9):
Chromosome 12 (position 20382849)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19164693
GRCz11 12 19286567
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGGCCCGGCACAGCAGCAGCAGCAACCACAATCACAGCCTCAGCAGTG[T/A]CAGTCAGTGGACACAGGGGCCATGCAAGGGGGCTGGGGAAGACCAGCAGG
Long Flanking Sequence:
TCATCAGAAGGCCAAGTAAAGGGCTGGGAAAGCGAGGGACATGAGTGGCGAGAACGGCGAGCAGGAGGTTCGTCAGGTGGGTGGGGAGATTTCCAAACACAGGGTACTCCATCAACAGGAGGAAGTGGCTGGGGAGATAGTCAGGAGGAGAAAGGAACAAGATCAAGTGGATGGAAAGAAATGGGGAGGGTGGATGCAGGCAGCTGGGGACCGAGAGGTACCAGCGACTGGGGAGAAAAAGAGTCTAAATCGTGTAGTGGGGGGTGGGATGGAAAGGGTGGTGGAGGTACTAGTGGAGACTCAGAAGTGGGTACATGGGGTAATTGGGATGATGGAACTCCTGGAGGGACATGGGGAGGGGTGGGTGGAGACATGGGTGGAAAATCTCACCAAGGTTGGGGTGGGAAGATGCACCCTTCACAAATGCCAAACAGCCAATCAGCCTCACAGAAAGGCCCGGCACAGCAGCAGCAGCAACCACAATCACAGCCTCAGCAGTG[T/A]CAGTCAGTGGACACAGGGGCCATGCAAGGGGGCTGGGGAAGACCAGCAGGTCCTTCAGTCCAGAGCCAAAGTTCAGGGTGGAATTCAGGGCCTATACCCCAAATTTCCAATGGCCCTGGAGAGACTTCAGAGCCCAGCGGTTGGGAGGAGCCTTCTCCACAGTCCATCAGCAGGAAAATGGAAATTGATGATGGAACATCTGCTTGGGGTGACCCCAGCAACTACAACTACAAAAGTGTCAACTTGTGGGATAAAAACAATGCCCCATCTGGCCAGGCACAATCAGTGTCCCCTCAGCAGGGCCCCCCACCCCTGCAACAGCCGCCACCAGGAAGAATGCCAACAGGTCTTGGGAATAGGGACATGAACATTGCACATTCAGCAAGCAAGGGGCCAGGAATAGGTAAGAGACTTGTTTTATTCAAATTATAGTTTCATTTAACCATTGTCAAAACAGTTGAAATTCAGCATCAAACACCCAAACTAAAAAAAGGTCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45458
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114402 Essential Splice Site 808 1736 8 27
Genomic Location (Zv9):
Chromosome 12 (position 20382908)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19164752
GRCz11 12 19286626
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACACAGGGGCCATGCAAGGGGGCTGGGGAAGACCAGCAGGTCCTTCAG[T/C]CCAGAGCCAAAGTTCAGGGTGGAATTCAGGGCCTATACCCCAAATTTCCA
Long Flanking Sequence:
AGCAGGAGGTTCGTCAGGTGGGTGGGGAGATTTCCAAACACAGGGTACTCCATCAACAGGAGGAAGTGGCTGGGGAGATAGTCAGGAGGAGAAAGGAACAAGATCAAGTGGATGGAAAGAAATGGGGAGGGTGGATGCAGGCAGCTGGGGACCGAGAGGTACCAGCGACTGGGGAGAAAAAGAGTCTAAATCGTGTAGTGGGGGGTGGGATGGAAAGGGTGGTGGAGGTACTAGTGGAGACTCAGAAGTGGGTACATGGGGTAATTGGGATGATGGAACTCCTGGAGGGACATGGGGAGGGGTGGGTGGAGACATGGGTGGAAAATCTCACCAAGGTTGGGGTGGGAAGATGCACCCTTCACAAATGCCAAACAGCCAATCAGCCTCACAGAAAGGCCCGGCACAGCAGCAGCAGCAACCACAATCACAGCCTCAGCAGTGTCAGTCAGTGGACACAGGGGCCATGCAAGGGGGCTGGGGAAGACCAGCAGGTCCTTCAG[T/C]CCAGAGCCAAAGTTCAGGGTGGAATTCAGGGCCTATACCCCAAATTTCCAATGGCCCTGGAGAGACTTCAGAGCCCAGCGGTTGGGAGGAGCCTTCTCCACAGTCCATCAGCAGGAAAATGGAAATTGATGATGGAACATCTGCTTGGGGTGACCCCAGCAACTACAACTACAAAAGTGTCAACTTGTGGGATAAAAACAATGCCCCATCTGGCCAGGCACAATCAGTGTCCCCTCAGCAGGGCCCCCCACCCCTGCAACAGCCGCCACCAGGAAGAATGCCAACAGGTCTTGGGAATAGGGACATGAACATTGCACATTCAGCAAGCAAGGGGCCAGGAATAGGTAAGAGACTTGTTTTATTCAAATTATAGTTTCATTTAACCATTGTCAAAACAGTTGAAATTCAGCATCAAACACCCAAACTAAAAAAAGGTCTCAGCATATCTTAAAAACAAATTTAAAAAAAAAATTAATTCTTTTATTTATATTTTAGCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11065
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114402 Nonsense 838 1736 9 27
Genomic Location (Zv9):
Chromosome 12 (position 20383074)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19164918
GRCz11 12 19286792
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAATGGAAATTGATGATGGAACATCTGCTTGGGGTGACCCCAGCAACTA[C/A]AACTACAAAAGTGTCAACTTGTGGGATAAAAACAATGCCCCATCTGGCCA
Long Flanking Sequence:
GACTGGGGAGAAAAAGAGTCTAAATCGTGTAGTGGGGGGTGGGATGGAAAGGGTGGTGGAGGTACTAGTGGAGACTCAGAAGTGGGTACATGGGGTAATTGGGATGATGGAACTCCTGGAGGGACATGGGGAGGGGTGGGTGGAGACATGGGTGGAAAATCTCACCAAGGTTGGGGTGGGAAGATGCACCCTTCACAAATGCCAAACAGCCAATCAGCCTCACAGAAAGGCCCGGCACAGCAGCAGCAGCAACCACAATCACAGCCTCAGCAGTGTCAGTCAGTGGACACAGGGGCCATGCAAGGGGGCTGGGGAAGACCAGCAGGTCCTTCAGTCCAGAGCCAAAGTTCAGGGTGGAATTCAGGGCCTATACCCCAAATTTCCAATGGCCCTGGAGAGACTTCAGAGCCCAGCGGTTGGGAGGAGCCTTCTCCACAGTCCATCAGCAGGAAAATGGAAATTGATGATGGAACATCTGCTTGGGGTGACCCCAGCAACTA[C/A]AACTACAAAAGTGTCAACTTGTGGGATAAAAACAATGCCCCATCTGGCCAGGCACAATCAGTGTCCCCTCAGCAGGGCCCCCCACCCCTGCAACAGCCGCCACCAGGAAGAATGCCAACAGGTCTTGGGAATAGGGACATGAACATTGCACATTCAGCAAGCAAGGGGCCAGGAATAGGTAAGAGACTTGTTTTATTCAAATTATAGTTTCATTTAACCATTGTCAAAACAGTTGAAATTCAGCATCAAACACCCAAACTAAAAAAAGGTCTCAGCATATCTTAAAAACAAATTTAAAAAAAAAATTAATTCTTTTATTTATATTTTAGCTTCTGGGTGGGGAGGTCGTGGCTCTCCTTCCAGTCCTTGTGTGGACAATGGTACTTCAGCCTGGGGTAAACCTACTGAAGCTCCCACTGGTTGGGATGACAGTGGCAAGGCCTCAAGTTGGGGGGATCCCTCATCCAATCCAGTGAAGTCTGGTGAGTCTAGATTTTAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27941
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114402 Nonsense 970 1736 11 27
Genomic Location (Zv9):
Chromosome 12 (position 20383822)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19165666
GRCz11 12 19287540
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGGTGGTGTTTGGAATAGTGCTGGTTCCCAAGGCAGCAGCTCTTCATA[T/G]AATTCTGGAGGCTGGGGAGCCAAAAAGGGCAACAAGGTATGTCATTGGTC
Long Flanking Sequence:
AAACACCCAAACTAAAAAAAGGTCTCAGCATATCTTAAAAACAAATTTAAAAAAAAAATTAATTCTTTTATTTATATTTTAGCTTCTGGGTGGGGAGGTCGTGGCTCTCCTTCCAGTCCTTGTGTGGACAATGGTACTTCAGCCTGGGGTAAACCTACTGAAGCTCCCACTGGTTGGGATGACAGTGGCAAGGCCTCAAGTTGGGGGGATCCCTCATCCAATCCAGTGAAGTCTGGTGAGTCTAGATTTTAAAATAATTGCGGTGGTTTTTTGATCAATTTCAATCCTGAATGTATTGATATTTCTGAACAGTTTAAAGGTAGATAGTAAAATTCTAAACAGTTTAATGTTGATATTTTTACAGGTTCAAAGTCTATGCAAGAAGGTTGGGTAGAAGGAGAGGGTTCAGTCAGTGCTTCGCGTAACCCTAGCTGGGAGGAGGAGGATGAGAGTGGTGGTGTTTGGAATAGTGCTGGTTCCCAAGGCAGCAGCTCTTCATA[T/G]AATTCTGGAGGCTGGGGAGCCAAAAAGGGCAACAAGGTATGTCATTGGTCAGACTAGGGAACAATATTTATACAAATCTGGAAACTAATCAGGATCTTTATATCTGGTTAATACATTACATTTTTTTCAGGGCTCCTTGAAGGGTGCAGGAGATTCTTGGATGAACCCAATGTCAAGACAGTTTTCAAATATGGGAATTTTGGTAAGAACATTTAGTATTATATTGGTGTATAATGTGGCTCAAGTTAATAAAAACTGATTCAAATCATCAGATGCAGTTTTGTTTTTGGTTGGCTTTAATAATAATTGCCTTTAAACCTGTTTACCCGATATTTGTGAATAATATATTACATAATATTATATAATGCTTCTTTATTAATATGTTATGGTTAAACCATGAGATTTAACAATGCTGACATGTTAATAGGGAGAGGACGCAGGTGGCCGTTCCTTGGATTTGGCCCCTGGTCCTCCACAGGACAAAAAGATGGAAGGAGAGA
Associated Phenotype:
Not determined