Busch Lab

ZMP

si:dkey-210m15.4

Ensembl ID:
ENSDARG00000074158
ZFIN ID:
ZDB-GENE-090313-233
Description:
Novel protein similar to vertebrate kinesin family member 16B (KIF16B) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
KIF16B
Human Description:
kinesin family member 16B [Source:HGNC Symbol;Acc:15869]
Mouse Orthologue:
Kif16b
Mouse Description:
kinesin family member 16B Gene [Source:MGI Symbol;Acc:MGI:1098240]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa19595 Essential Splice Site Available for shipment Available now
sa25671 Nonsense Mutation detected in F1 DNA Not yet available
sa19594 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19595
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109333 Essential Splice Site 90 1318 4 30
ENSDART00000131674 None None 152 None 4
ENSDART00000140079 None None 491 None 11
Genomic Location (Zv9):
Chromosome 1 (position 51776244)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50622511
GRCz11 1 51266310
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTTTCGCGAGCTGAATATTGGCTCTGAGTCATGACTTGCTACTTTATA[G/T]GGAGACCTCGGACTGATCCCACGCATCTGTGAAGGATTATTCAGCCGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25671
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109333 Nonsense 143 1318 5 30
ENSDART00000131674 None None 152 None 4
ENSDART00000140079 None None 491 None 11
Genomic Location (Zv9):
Chromosome 1 (position 51774892)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50621159
GRCz11 1 51264958
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAACGAGCGCGTGCGGGATTTGTTACGGAGAAAGATGGCAAAAACTTA[T/A]AACCTCAGAGTCAGAGAGCACCCTAAAGAGGGACCCTATGTAGAAGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19594
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109333 Nonsense 557 1318 16 30
ENSDART00000131674 None None 152 None 4
ENSDART00000140079 Nonsense 192 491 7 11
Genomic Location (Zv9):
Chromosome 1 (position 51765846)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50612343
GRCz11 1 51256142
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTTCTCACCAGCCTGAGCTTATCCATGTCTGATCTGTCTAAATCCTGT[G/T]AAAACCTCTCCACCGTCATGCTCTATAACCCTGGGTAAGCCGCTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25670
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109333 Essential Splice Site 1265 1318 29 30
ENSDART00000131674 Essential Splice Site 99 152 3 4
ENSDART00000140079 None None 491 None 11
Genomic Location (Zv9):
Chromosome 1 (position 51742356)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50588853
GRCz11 1 51232652
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGGAACCGAGACGAGCGGACGATCGCGGAGCGCCGGAACCAGCTGGAGG[T/G]GATCAGATGCGTTTTACGTTCATTCAGTCGTCGGCCAATGAAAAACCACT
Associated Phenotype:
Not determined