Busch Lab

ZMP

myo10l3

Ensembl ID:
ENSDARG00000074143
ZFIN ID:
ZDB-GENE-070912-237
Human Orthologue:
MYO10
Human Description:
myosin X [Source:HGNC Symbol;Acc:7593]
Mouse Orthologue:
Myo10
Mouse Description:
myosin X Gene [Source:MGI Symbol;Acc:MGI:107716]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa17384 Nonsense Available for shipment Available now
sa17549 Nonsense Available for shipment Available now
sa7176 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31704 Nonsense Available for shipment Available now
sa34571 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21444 Essential Splice Site Available for shipment Available now
sa41370 Nonsense Mutation detected in F1 DNA Not yet available
sa7175 Nonsense Mutation detected in F1 DNA Not yet available
sa7174 Nonsense Mutation detected in F1 DNA Not yet available
sa2501 Nonsense F2 line generated Not yet available
sa41369 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17384
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 213 2023 5 40
ENSDART00000138360 None None 916 None 16
ENSDART00000146265 Nonsense 212 684 5 18
ENSDART00000088042 Nonsense 213 2023 5 40
ENSDART00000138360 None None 916 None 16
ENSDART00000146265 Nonsense 212 684 5 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13028744)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12781309
GRCz11 9 12752512
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATACWGTTGCWTTAAATCCTTTAACATTTSTCTCCAGAATCGAGTTGTG[C/T]GACAAAATCCAGGAGAAAGAAACTATCATATTTTCTATGCCTTRTTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17549
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 213 2023 5 40
ENSDART00000138360 None None 916 None 16
ENSDART00000146265 Nonsense 212 684 5 18
ENSDART00000088042 Nonsense 213 2023 5 40
ENSDART00000138360 None None 916 None 16
ENSDART00000146265 Nonsense 212 684 5 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13028744)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12781309
GRCz11 9 12752512
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATACWGTTGCWTTAAATCCTTTAACATTTSTCTCCAGAATCGAGTTGTG[C/T]GACAAAATCCAGGAGAAAGAAACTATCATATTTTCTATGCCTTRTTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7176
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Essential Splice Site 272 2023 6 40
ENSDART00000138360 None None 916 None 16
ENSDART00000146265 Essential Splice Site 271 684 6 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13028444)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12781009
GRCz11 9 12752212
KASP Assay ID:
554-5240.1 (used for ordering genotyping assays)
KASP Sequence:
GTGTAAAAGACAGAAGCCTAGATGACAAACACCTCTATGATAGTGTAATG[G/A]TGAGTCAAGAAATTGCTTTATTATCTTTGTGTGAAAGCATTGTTCTCGYR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31704
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 436 2023 10 40
ENSDART00000138360 None None 916 None 16
ENSDART00000146265 Nonsense 435 684 10 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13019594)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12772159
GRCz11 9 12743362
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCAGGAGTACTTCAACAAGCACATCTTCTCCCTGGAGCAGCTTGAATA[T/A]AACAGGTGAGTCCTGTCAATGGCCCTGGTTAGCACAGATCCAGATATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34571
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Essential Splice Site 647 2023 None 40
ENSDART00000138360 None None 916 None 16
ENSDART00000146265 Essential Splice Site 646 684 None 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 12988139)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12740704
GRCz11 9 12711907
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGTGGAGAGTGTATGTGAGTGTTTTCAAGCTGTACCCACTTCCTGTGC[A/T]GATACACTATGATCCTGAGGGACAGAAACCACACGGCGGACGAGAGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21444
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Essential Splice Site 685 2023 18 40
ENSDART00000138360 None None 916 None 16
ENSDART00000146265 None 684 684 18 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 12988022)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12740587
GRCz11 9 12711790
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACGAAGTACGACGTCACGAAGAAAGAGTGGCAGCTGGGGAAGACTAAG[G/A]TGTGGTTGCATGACCAGCACATGTTCACACACTGTTTTAAGTAGAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41370
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 1489 2023 33 40
ENSDART00000138360 Nonsense 380 916 9 16
ENSDART00000146265 None None 684 None 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 12948748)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12701313
GRCz11 9 12672516
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTGGTGGTTGTGCAGGAGAGCAGTCTGAATGTGGAGGCTGTGGAG[C/T]AGATGTACTGGAGGAACCCCATCCTGAGATACACACAGCACCCGCTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7175
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 1506 2023 33 40
ENSDART00000138360 Nonsense 397 916 9 16
ENSDART00000146265 None None 684 None 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 12948696)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12701261
GRCz11 9 12672464
KASP Assay ID:
554-4767.1 (used for ordering genotyping assays)
KASP Sequence:
GATGTACTGGAGGAACCCCATCCTGAGATAYACACAGCACCCGCTGCACT[C/A]GCCCCTGCTGCCCCTGCCATAMGGAGAAGTCAACATCAACYGTGAGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7174
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 1513 2023 33 40
ENSDART00000138360 Nonsense 404 916 9 16
ENSDART00000146265 None None 684 None 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 12948674)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12701239
GRCz11 9 12672442
KASP Assay ID:
554-5121.1 (used for ordering genotyping assays)
KASP Sequence:
CTGAGATAYACACAGCACCCGCTGCACTMGCCCCTGCTGCCCCTGCCATA[C/A]GGAGAAGTCAACATCAACYGTGAGCCTCCATTTTACCCTCATCTGCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2501
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 2010 2023 40 40
ENSDART00000138360 Nonsense 901 916 16 16
ENSDART00000146265 None None 684 None 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 12940655)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12693220
GRCz11 9 12664423
KASP Assay ID:
554-3013.1 (used for ordering genotyping assays)
KASP Sequence:
GAGAGATAACCAAAATAATGAAAGCCTACATCAACATGATTGTTAAGAAA[C/T]GATGCAGTGTCAGATCAGTGGCCAGCTTTGGGAGCAACTGGATCAGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41369
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 2011 2023 40 40
ENSDART00000138360 Nonsense 902 916 16 16
ENSDART00000146265 None None 684 None 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 12940650)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12693215
GRCz11 9 12664418
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAACCAAAATAATGAAAGCCTACATCAACATGATTGTTAAGAAACGATG[C/A]AGTGTCAGATCAGTGGCCAGCTTTGGGAGCAACTGGATCAGGTGATGAGT
Associated Phenotype:
Not determined