Busch Lab

ZMP

si:ch211-77o19.1

Ensembl ID:
ENSDARG00000074126
ZFIN ID:
ZDB-GENE-091116-42
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JLE4]
Human Orthologue:
TTC39A
Human Description:
tetratricopeptide repeat domain 39A [Source:HGNC Symbol;Acc:18657]
Mouse Orthologue:
Ttc39a
Mouse Description:
tetratricopeptide repeat domain 39A Gene [Source:MGI Symbol;Acc:MGI:2444350]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa21234 Nonsense Available for shipment Available now
sa41160 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41159 Nonsense Mutation detected in F1 DNA Not yet available
sa30638 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa21234
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108659 Nonsense 127 635 5 19
ENSDART00000132681 Nonsense 163 222 6 9
ENSDART00000146469 Nonsense 127 598 5 20
Genomic Location (Zv9):
Chromosome 8 (position 17012249)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16457137
GRCz11 8 16492849
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATATTTGCTGCAGGAAACACAATGAAGGAGGCACAGGCTGTGTGTCAA[C/T]GGTGGGTTATATTCCGTTTCTAATAATCTTTCTTTTTGCGTATATATGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27157
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108659 Nonsense 130 635 6 19
ENSDART00000132681 Nonsense 166 222 7 9
ENSDART00000146469 Nonsense 130 598 6 20
Genomic Location (Zv9):
Chromosome 8 (position 17006634)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16451522
GRCz11 8 16487234
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTTTACGACAAGACTGATAAGGATGTGTGTATTATTACAGATACCGC[A/T]AAAAGTCTTCATTCAACAGCAAAAACTTCACCGAAGGTTGGTGCCTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41160
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108659 Essential Splice Site 142 635 6 19
ENSDART00000132681 Essential Splice Site 178 222 7 9
ENSDART00000146469 Essential Splice Site 142 598 6 20
Genomic Location (Zv9):
Chromosome 8 (position 17006596)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16451484
GRCz11 8 16487196
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAGATACCGCAAAAAGTCTTCATTCAACAGCAAAAACTTCACCGAAGG[T/G]TGGTGCCTGTTATATTCATATTTCTCTAAATGACTGGTTGCTATTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41159
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108659 Nonsense 540 635 17 19
ENSDART00000132681 None None 222 None 9
ENSDART00000146469 Nonsense 503 598 18 20
Genomic Location (Zv9):
Chromosome 8 (position 16993523)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16438411
GRCz11 8 16474123
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACCACAGATGACCAGTGTGTGGTTAGTTTGCTGAAGGGCCTCTGTCTC[A/T]AACACTTGGGTTACAAGGAGGAAGCAGAACATTACTTCACCCTCGTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30638
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108659 Essential Splice Site 558 635 17 19
ENSDART00000132681 None None 222 None 9
ENSDART00000146469 Essential Splice Site 521 598 18 20
Genomic Location (Zv9):
Chromosome 8 (position 16993466)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16438354
GRCz11 8 16474066
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGTTACAAGGAGGAAGCAGAACATTACTTCACCCTCGTCCTCTGCAAG[T/G]CAGTCTTACGCTTTTGCTTCGCAACAAATCACACTGATATGAAAAGAAGT
Associated Phenotype:
Not determined