Busch Lab

ZMP

ftr15

Ensembl ID:
ENSDARG00000074118
ZFIN ID:
ZDB-GENE-070912-394
Description:
FinTRIM family protein [Source:UniProtKB/TrEMBL;Acc:B5WXZ9]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa33004 Nonsense Mutation detected in F1 DNA Not yet available
sa637 Nonsense F2 line generated Not yet available
sa25886 Nonsense Mutation detected in F1 DNA Not yet available
sa19851 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33004
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044446 None None 275 None 5
ENSDART00000061170 Nonsense 58 476 1 6
ENSDART00000098281 None None 432 None 7
ENSDART00000111305 None None 182 None 2
ENSDART00000112439 None None 455 None 7
ENSDART00000114713 None None 94 None 2
Genomic Location (Zv9):
Chromosome 2 (position 43252305)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43301769
GRCz11 2 43151187
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTATTGGGATCAGGATAAGCAGAGGGGAGTCTACATCTGCCCTCAGTGC[A/T]GACAGACCTTCACTCCAAGACCTGCTTTAGGGAAAAACACCATGCTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa637
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044446 Nonsense 134 275 2 5
ENSDART00000061170 Nonsense 199 476 2 6
ENSDART00000098281 Nonsense 134 432 2 7
ENSDART00000111305 None None 182 None 2
ENSDART00000112439 Nonsense 134 455 2 7
ENSDART00000114713 None None 94 None 2
Genomic Location (Zv9):
Chromosome 2 (position 43251788)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43301252
GRCz11 2 43150670
KASP Assay ID:
554-0546.1 (used for ordering genotyping assays)
KASP Sequence:
GTAGTAAATGTAATGTATTTACTGTATTCTATGATTTCTGCAGAGGCAGT[T/A]GGAGGAAACCCAGAGTAAACATAATCAGAGAATCCAGAGGAAACAGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25886
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044446 Nonsense 156 275 2 5
ENSDART00000061170 Nonsense 221 476 2 6
ENSDART00000098281 Nonsense 156 432 2 7
ENSDART00000111305 None None 182 None 2
ENSDART00000112439 Nonsense 156 455 2 7
ENSDART00000114713 None None 94 None 2
Genomic Location (Zv9):
Chromosome 2 (position 43251723)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43301187
GRCz11 2 43150605
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAAACATAATCAGAGAATCCAGAGGAAACAGGAGGAGTGTGTGGAGCTG[A/T]GAGTGGCTATAGAGTCTCAGAAGGTGAGTTTTGAGCAGAAGATCAACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19851
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044446 None None 275 None 5
ENSDART00000061170 None None 476 None 6
ENSDART00000098281 Nonsense 415 432 6 7
ENSDART00000111305 None None 182 None 2
ENSDART00000112439 Nonsense 415 455 6 7
ENSDART00000114713 None None 94 None 2
Genomic Location (Zv9):
Chromosome 2 (position 43246044)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43295508
GRCz11 2 43144926
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGGACGTAATGATCAGTCCTGGGGTTTGTCCTGCTCTAGATCAAGATG[T/A]TCATTCTGCCACAATAAAAAACAGACCAAACTGCCAGTAATGTCCAACTC
Associated Phenotype:
Not determined