Busch Lab

ZMP

ENSDARG00000074116

Ensembl ID:
ENSDARG00000074116
Human Orthologue:
AC092718.1
Mouse Orthologue:
Pkd1l2
Mouse Description:
polycystic kidney disease 1 like 2 Gene [Source:MGI Symbol;Acc:MGI:2664668]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa44678 Nonsense Mutation detected in F1 DNA Not yet available
sa41069 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44678
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114562 Nonsense 212 488 4 8
Genomic Location (Zv9):
Chromosome 7 (position 67045191)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64960175
GRCz11 7 65184203
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCATACTACCTTACACATCATATTCGACAGAGCTTCAGCACTGGCATTT[C/A]AGAGACTCTGAACCACAAAGATATTTTCATTTGGGCAAATTCTTCCTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41069
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114562 Nonsense 330 488 5 8
Genomic Location (Zv9):
Chromosome 7 (position 67043236)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64958220
GRCz11 7 65182248
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCAGGCCAAACTTCGGGCAAACCCTGTTTGGGGTGGTCTGGCCCTATA[T/G]AAAGGAGGAGGATTTGTGGTGGACCTAGGTCCAGATCAAAAGAATGCAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7100
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114562 Nonsense 472 488 8 8
Genomic Location (Zv9):
Chromosome 7 (position 67042516)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64957500
GRCz11 7 65181528
KASP Assay ID:
554-5469.1 (used for ordering genotyping assays)
KASP Sequence:
AGTTAGCCATCATCATTTTAAGCTGGRGCGCWTTATCTGTGTTTGTCAAG[A/T]GAACAATATTGGGTAACAGGGACATTGAGTTCTACCAAAATAACAAAGAC
Associated Phenotype:
Not determined