Busch Lab

ZMP

LOC100004620

Ensembl ID:
ENSDARG00000074081
Human Orthologue:
DNAI2
Human Description:
dynein, axonemal, intermediate chain 2 [Source:HGNC Symbol;Acc:18744]
Mouse Orthologue:
Dnaic2
Mouse Description:
dynein, axonemal, intermediate chain 2 Gene [Source:MGI Symbol;Acc:MGI:2685574]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa45476 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa12575
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003339 Nonsense 106 604 2 12
ENSDART00000003339 Nonsense 106 604 2 12
Genomic Location (Zv9):
Chromosome 12 (position 40240380)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 38522214
GRCz11 12 38696725
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGGAGGCCACCATCCGCTACAGGAAGAAAGTGGAGAAGGATGAACACTA[T/A]CAGAACACCATTATGCAGATTGCTGGTGTGAGTGGCCGCTAAACTTATAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28002
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003339 Nonsense 106 604 2 12
ENSDART00000003339 Nonsense 106 604 2 12
Genomic Location (Zv9):
Chromosome 12 (position 40240380)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 38522214
GRCz11 12 38696725
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGAGGCCACCATCCGCTACAGGAAGAAAGTGGAGAAGGATGAACACTA[T/G]CAGAACACCATTATGCAGATTGCTGGTGTGAGTGGCCGCTAAACTTATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45476
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003339 Nonsense 242 604 5 12
Genomic Location (Zv9):
Chromosome 12 (position 40243589)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 38525423
GRCz11 12 38699934
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTACAACCCGAAAGATTCACACATTCTCATTGGCGGCAGCTACAATGGA[C/T]AAATCGGTGGGTTTTATCACACAATTTTTAGATACACAATAAATCTTAGC
Associated Phenotype:
Not determined