Busch Lab

ZMP

LOC100004261

Ensembl ID:
ENSDARG00000074060
Human Orthologue:
MAP3K14
Human Description:
mitogen-activated protein kinase kinase kinase 14 [Source:HGNC Symbol;Acc:6853]
Mouse Orthologue:
Map3k14
Mouse Description:
mitogen-activated protein kinase kinase kinase 14 Gene [Source:MGI Symbol;Acc:MGI:1858204]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa40121 Nonsense Mutation detected in F1 DNA Not yet available
sa26126 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11635 Nonsense Available for shipment Available now
sa2107 Nonsense F2 line generated Not yet available
sa40122 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40121
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110791 Nonsense 7 825 1 15
Genomic Location (Zv9):
Chromosome 3 (position 37720169)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37583529
GRCz11 3 37725387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTGTTCATTTGTGTCATAGAGTTTGAAGATGCAGGTGCAAAGAATTTG[G/A]AACTCCACCGTCCCATTCTCTCACATGGCCCATAGTGATATAAAAGCTGT
Long Flanking Sequence:
AGCACGACCGCCTCACAGCAAGAAGGTCGCTGGTTCGAGCCCCAGCTGGGTCAGTTGGCATTTCTGTTTGGTGTTTGCATGTTCTTCCTGTGTTTGTGTGGGAGTCTTCCGGGTGCTCCGGTTTTCCCCACAGTCCAAAGACATGAAGTATAGGTGGGTTGAATAAGCTAAATTGGAAACCCACGCGGACACGGGGAGAACATGCAATTTCCACACAGGAATGGGAACAGGCACAGCCGGGACTTTAACCAGTGACATTCTTGCTGTGAGGCGACAGTGCTAACTACTGAGCCTCCAAGCTGCCTTACTAAATTCAATCAATCATTTTTTTTTTCAGTAAACCATAAACAATCTATTTTGTGACACTACGAAATAAGCAGTAGAGGATAATATGAAACTATAAACTTTTGTCCATACAATATTTTACGTCATATTGCATAGGTCTAATCGATCTGTTCATTTGTGTCATAGAGTTTGAAGATGCAGGTGCAAAGAATTTG[G/A]AACTCCACCGTCCCATTCTCTCACATGGCCCATAGTGATATAAAAGCTGTCAACCGCCTTGGCTCAGGTCCAGACTCTAGCACAGAGAGCGAAGGAGGAGAGCTGGAAAAAATAGTTCATAACAGCGCTCTGTGGAAGATCATAAATCACGGAACTGCCAAATATGAGTGGACACACGGGACAGAGAAACAGTCCATTATTGCACAGGCGGAGTGTAAGTGTTGGTTTAAAGACACTGAAACAATGACCTAGGTGTTTTAATCAAATTTAAATGTAATTGAATTCTTTCTCTTTTTCATAGGTGAGTCTCAGGATTCACAGGAGTTCTGCCCCAATGGCAGGTAAAGATCTATGTCAAGTCAATTTTAATTTATAAAATGCTTTTAAGAAATAACAATAAGTGCTTACCAAAGTTCTGTACAAGCATACACCATTTAAAACAAAAGACATAAAAATTTAAATACTCTCATACGGTGTTAAAACCAAAGAGTAGAAATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26126
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110791 Essential Splice Site 147 825 3 15
Genomic Location (Zv9):
Chromosome 3 (position 37720973)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37584333
GRCz11 3 37726191
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCAGAGTGCCAGAACAGGACAGCGGAGAAGGGTCGTCTATCAATCAGG[T/C]ACGGCCTAATTACCTATAATTATAACAACTGATGAAAATTGTAAAAACAT
Long Flanking Sequence:
GAGTCTCAGGATTCACAGGAGTTCTGCCCCAATGGCAGGTAAAGATCTATGTCAAGTCAATTTTAATTTATAAAATGCTTTTAAGAAATAACAATAAGTGCTTACCAAAGTTCTGTACAAGCATACACCATTTAAAACAAAAGACATAAAAATTTAAATACTCTCATACGGTGTTAAAACCAAAGAGTAGAAATGAATATGTAAAGATTTGATCTAAAAACAGGAATGTATATGACTTTAACACACAAATGTTTTCGATATGTTCTCTTTCAATATGAGGAATGAATAAATCACTGCGGTTTACATGTTTTGTGATATCTTCTTCCACGTTAGCATCTCCTCCCAGTTGGTTCTCAGCTCCATCAGTCGTAACCGGCCCAGAAAGAAACGTAAGAGGCCGCGACGGAAACAGGGCAAGAACGTCAGCCAAGCAAATGTGTCTGTGGGAGTCACCAGAGTGCCAGAACAGGACAGCGGAGAAGGGTCGTCTATCAATCAGG[T/C]ACGGCCTAATTACCTATAATTATAACAACTGATGAAAATTGTAAAAACATTATCAGTCAGTCAGAGAAATTAAAGTAGCTGATGACATAGCTTAAATATATATAGTATATAATAGCAACACTCATCAAGACAACAACATTAATCAAGAACTTACAAACAAATTAGTCCCATACATATTACTGCAGATCGTTCTTTACAAACACCCCATTCACATCAAACAGTGATTCGAATTAAGACAACTGCAACTAGGATGAATGACTTTTCATAAGCAATTTTTTCGGGCTCTAGGAATTTTAAACCTGCGTCCTGATGGTAACATTTCAAATGCTGAGTAAAGGGGATGTGTATTATCTTTAAAAATCACAACTGCTGTTTTTTCCATAAAGAAACCAAATAGAATCTGCAGCGAATGTTGTTTGTAACCAGTTATCTTATTTGCCTGTTTGATAATTTGCGTCTAATATAGTTTGCCTTAAATATACAGATTGCTTTATGCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11635
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110791 Nonsense 184 825 4 15
Genomic Location (Zv9):
Chromosome 3 (position 37722543)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37585903
GRCz11 3 37727761
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATCCATCCAGGAAACCGAGGGTCCATCAGACTCTCATCAGTGGGAGTCA[C/T]AGCAGACCTCCTTTTTCTCCCCYAGCCAGAGTTATGCCGAAGAGAGCGAG
Long Flanking Sequence:
GCACTGAGAGGCTAAGTGCCTCTCAGTTTCAGCATAACTTTGCTGATGTCTAAAAGCGTCCAAGCACACTATATTTAGGAACTGAATGCATGTAAAAAATCTATATAGCCCATCTGTTAATTTCATTTAAGGTTAGACTTATTTCAGCTTATGTTATATCCCAGAGGAAATCCAATGTTTAGCCAACTATTGATTTTTTTGTATTTTTAATAATGTTAAATGTTAATAAAATGTTTAATAATATTATATTATATTATATTATTATATTATATTAAAGTATATTTTATAACATATTACTTTTAAAAGTAATTTTACACAACACCGTTCCCACTCTGCACTGGTTTTATAAGTGTTTTTCAGCAGTTCTCCTTTCTTGTGTCCTCTTTCTTCAGGTTAGAGAGCCAGTGTTCTTCAGCAGCAACAGTAGCAGCACATACAGCACAGAAAGAGTATCCATCCAGGAAACCGAGGGTCCATCAGACTCTCATCAGTGGGAGTCA[C/T]AGCAGACCTCCTTTTTCTCCCCTAGCCAGAGTTATGCCGAAGAGAGCGAGGAGCTGAAGTCTCAGCTGAGAAGCGAAATCGAATGCTCTTTGGCAGTCACGGCCCTCAGAGACTATGTAACAACAGAAGAACCCTGCTTTGCATACGGCTTTGTAAAAGACGTGCTGAGACAAAAGAGGGAGAAGGACGAGGACGAAAGAGAGGACAGCGATAAGAACGAAGGCATCCTGTTCAAAGAGGTGATTTGCCATTTTAAAAACAAGGCACGGTGAAATTGACGAGGATGAAGTCATACCGAAAGATGCGACGCTTTGATCTGTTTTCTCGCACGCTAAGATGCTAATTTGCATGCAAGCACACATTACGAAAGTTATATAAACACACACAATAAAGACAATACAAATAAAGACAACAGAGGCACACTAATATAGAGAGAGAGTGAGACACACAAGGGCACATGCCTGCATGTGTACACATAGCTAGAAGCTGCGGTTGTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2107
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110791 Nonsense 361 825 7 15
Genomic Location (Zv9):
Chromosome 3 (position 37726863)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37590223
GRCz11 3 37732081
KASP Assay ID:
554-2937.1 (used for ordering genotyping assays)
KASP Sequence:
CTGCTCTGYTTACACTCTCTTCAGGTTCTCTAGGACAGYTGGTGGAGGAA[C/T]GAGGCCGTCTGCCAGAGGATCTGTCCCTGCATTACCTTCAGCAAGTACTA
Long Flanking Sequence:
CTTTTAATGGGTGTGACAGAGAAAGGAGACAGCCAAAACATGGTTGAGAAACACTGCTGTAGAATACTTTAACTAATAGCATTTGATATAGTATGAATAAAATTTGCCAGACTTGTAAAGTGCATCTAGAAAGTGTTTAAATGTAACTTTGGAAAAGGGTGTAGGAAATCTATGTAAACAAAAGTTGGTTATTAAACTAAAATAGCTTCTGTGATTAGATTGACTTTATCTTGACTTTATTACATCAGAGATGTCACTTTGGGCACAATTGATTGGTTGAATCTCGGTTTGCGTCTTACAATGCATGCCAATGAATACCACTAAAAGCCAAACCACTTTCATAGTCCCTTAAACTCGAGAGTTTGTTCAAACTAAACTAAAACCAGCTAATCTGGCTTCATGGTACAGGCCCCCCAGTGTTCTGCTTTGTGAGGAGATGGATAGTTTGATCTGCTCTGTTTACACTCTCTTCAGGTTCTCTAGGACAGCTGGTGGAGGAA[C/T]GAGGCCGTCTGCCAGAGGATCTGTCCCTGCATTACCTTCAGCAAGTACTAGGGGCACTACACTACCTGCATAGGAAACGTGTGCTTCATCTGGACATCAAAGGTACAAAGATTGCTTTACTAATAATGTTTTGTTTTTGTATGTGGAGTACAAGCTACAAGTGTACAAGTGTACAAGGAGTACAAGTGTGCAGAGTCTTTGTTTTGCTTACTCAAATTCCCACTTCCAAACTGACATTTATGTGGACAGATGACATGACTGTGACATTTAACGTCCACATGTAGTTTATGTGGAAAGTGGACATCCCTTTTTATTTTACTTCCTTCATTGGAGAGACAGTTCATTGGAAACTTTTTAGAGAAATGAAAAATCACAAGTGAGTCTTTTAGGAAAAAGGCAAACCTCGTGTTTCTCAGAGTTGCTAATTTACTAGACAGCTGCATTTAAAGGTCAGAAAACTCCACTTCTGTGTTTTATTAAGATAAATCTGGAAGAAATAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26127
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110791 Essential Splice Site 395 825 7 15
Genomic Location (Zv9):
Chromosome 3 (position 37726967)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37590327
GRCz11 3 37732185
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACTACACTACCTGCATAGGAAACGTGTGCTTCATCTGGACATCAAAGG[T/A]ACAAAGATTGCTTTACTAATAATGTTTTGTTTTTGTATGTGGAGTACAAG
Long Flanking Sequence:
TGCCAGACTTGTAAAGTGCATCTAGAAAGTGTTTAAATGTAACTTTGGAAAAGGGTGTAGGAAATCTATGTAAACAAAAGTTGGTTATTAAACTAAAATAGCTTCTGTGATTAGATTGACTTTATCTTGACTTTATTACATCAGAGATGTCACTTTGGGCACAATTGATTGGTTGAATCTCGGTTTGCGTCTTACAATGCATGCCAATGAATACCACTAAAAGCCAAACCACTTTCATAGTCCCTTAAACTCGAGAGTTTGTTCAAACTAAACTAAAACCAGCTAATCTGGCTTCATGGTACAGGCCCCCCAGTGTTCTGCTTTGTGAGGAGATGGATAGTTTGATCTGCTCTGTTTACACTCTCTTCAGGTTCTCTAGGACAGCTGGTGGAGGAACGAGGCCGTCTGCCAGAGGATCTGTCCCTGCATTACCTTCAGCAAGTACTAGGGGCACTACACTACCTGCATAGGAAACGTGTGCTTCATCTGGACATCAAAGG[T/A]ACAAAGATTGCTTTACTAATAATGTTTTGTTTTTGTATGTGGAGTACAAGCTACAAGTGTACAAGTGTACAAGGAGTACAAGTGTGCAGAGTCTTTGTTTTGCTTACTCAAATTCCCACTTCCAAACTGACATTTATGTGGACAGATGACATGACTGTGACATTTAACGTCCACATGTAGTTTATGTGGAAAGTGGACATCCCTTTTTATTTTACTTCCTTCATTGGAGAGACAGTTCATTGGAAACTTTTTAGAGAAATGAAAAATCACAAGTGAGTCTTTTAGGAAAAAGGCAAACCTCGTGTTTCTCAGAGTTGCTAATTTACTAGACAGCTGCATTTAAAGGTCAGAAAACTCCACTTCTGTGTTTTATTAAGATAAATCTGGAAGAAATATATATATATATAACATATTATCATTTTTTTATGTAAAATTAAAAATGTGACAGTAAAATAAAAATAACATTTTCCTAAAATTATTATTATTATTTTTTTATCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40122
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110791 Essential Splice Site 728 825 13 15
Genomic Location (Zv9):
Chromosome 3 (position 37735658)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37599018
GRCz11 3 37740876
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTGACTGGCTCTCTCCAACTCACCAGCCTCTGTCACGCTGCTTTGAGGG[T/C]GAGTTAGACATCTGCTTCTTCTAATTTCTTGATATATCTGCAGAGATTTT
Long Flanking Sequence:
TGTTTACACGGCTCTTTATTGTCAATCTTGTGATGATCACAGTCTTCTGAACATTCTTCAGATGGAGATTTTAACATTTGTTTTGTTGTGTGTTTGTGTGTGTGCAGATTTCCTCTTGAGCAGCCTCTCTCATCTTCCCTCTGCTGAGCTTCAAGAGCAGCTTCTCTCCTGTATCAGCAGTGACTGTCTCTCCACTAGAGAATGCTGTGACAAAAAGGTAAGAAAAAAAACAACAACAGGCAACCATATGTGACAACGATCACCTGTTGGTTGCTAGAACATTTCACTTTAATCATTCAGAAGTAATTTAAAATTGAAGTGGTCTCTCAATTCTATCTTTTCTCTCTTCACTCTGTTCAGGATTCAGGCCGTTGGTCAGTCAGTCCTGGTGATTATGACAGCTCAGGTGTGTTTTCCGACAATAGCCAGTATGACGGGCAGACCTTCAGCCGTGACTGGCTCTCTCCAACTCACCAGCCTCTGTCACGCTGCTTTGAGGG[T/C]GAGTTAGACATCTGCTTCTTCTAATTTCTTGATATATCTGCAGAGATTTTGTGCTTTAGATTTTGTTTTCAAATCATAGGGCTGAATAATGTTGAAGAAAATGCACAATATTTAGTTTTTTCCTGCAGAATATACTGTAGCATATTGTGATAAAACAGGATTTTTGTAACTGTGCTGTGAAAAATGCAGGGTTCCACACAATTCATTCATGTTGTCCCAATTTAAATCTAAGTAAGAAACTTAAGTGGATTGTTATTTCAGCTTATTAATTAATTGATTATTATTTGGTACTAATGGGCTCGAAATGTGCCAAGAAAATATCCCCCACACCATTACTCCCCCCCCTATGCCATGCCACATTTAAAGTCACTTAAATCACCTTTCTTCTCCATTCGGATGCTCGGTTTAAACTGCAGCAGATCGTCTTGACATGTCTACATGCCTAAATCCATTGAGTTGCTGCCATTTGATTGGCTGATAAGAAATTTGCGTTAACTAGC
Associated Phenotype:
Not determined