Busch Lab

ZMP

dlg5

Ensembl ID:
ENSDARG00000074059
ZFIN ID:
ZDB-GENE-030131-3149
Description:
disks large homolog 5 [Source:RefSeq peptide;Acc:NP_001139075]
Human Orthologue:
DLG5
Human Description:
discs, large homolog 5 (Drosophila) [Source:HGNC Symbol;Acc:2904]
Mouse Orthologue:
Dlg5
Mouse Description:
discs, large homolog 5 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918478]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa45483 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35447 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13331 Nonsense Available for shipment Available now
sa22258 Essential Splice Site Available for shipment Available now
sa12813 Essential Splice Site Available for shipment Available now
sa15456 Essential Splice Site Available for shipment Available now
sa13023 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3842
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105496 Nonsense 722 1926 11 32
ENSDART00000124710 Nonsense 742 1958 12 33
Genomic Location (Zv9):
Chromosome 13 (position 16474081)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16294116
GRCz11 13 16425108
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGGATATTTGTTTCTCGGGTGGACAAAGGAAGTATCGCGGATGGAAGAT[T/A]GAGGTGAATTCACATATTGAGCGTTTTACAGATAATGGCCCGCTCATTTC
Long Flanking Sequence:
GTGTCCTTCAGTTGTACCCTTTAAAATCCTTCATTCTTAAAAGACCTTTGTAGTAGCCAGTTTTGAGCACTTCAGCTTTGAACGAAACCTCAATATGGCGGCCATGATTAACATGCAGACCAACATTTCAGCATTTGCCGTGCTTACTATTTACGGTATGTTCCAAATGGGATATTCCTCTCTAAAGGGCACTTAGGAGTGAAGTTTTTATAATATCGCAAAAACAAGACACCCAAAATGGCAGCAAAACCATCCATTCCTCACCTAGGTAGTGGAGGAGAAACATTTTGACCTTTGTCTGATTTTCGTCATTTTATCGTTTGTCTTTACTTAGATAAAATTGTTCTCCCTCTGACCATCATTATCTCCCAAACAGGACGACATGGATTTGAAGGCAATGGGGTTTGATATCGCAGAGGGGGTGAATGATCCATATTTACCAGGAGACTGTGGGATATTTGTTTCTCGGGTGGACAAAGGAAGTATCGCGGATGGAAGAT[T/A]GAGGTGAATTCACATATTGAGCGTTTTACAGATAATGGCCCGCTCATTTCACTGCCCGTCGTTTTGTCCTGACCAGCCGTGTCTTTCTCTCAATAGGGTGAATGATTGGCTGCTGAAGATAAATGATGTGGACCTGACGAACAAAGACAGGAAGCAGGTCATCAAAGCTGTACTTAATGGAGGAGGCCTGATCAATATGGTCGTTCGCAGGAGGAAATCTTTAGGAGGAAGGCTGGTTACTTCTGTTCACATTAATCTCATCGGACACAAAGGTATCACTTACTACTTTAAATTAGGCAGTTAAGAAACTTATTTTATAACTGTTATGGACGTGTATTTACAAGATGATGAATCGCTCATACAAAACTCCCACATTCTTATTTACTGAATGGGGTAGAGAAATCAATTTGTGATTTATGTAACAATCTCTTAAGTACAAAACACTTTTTAGTAGAATGTTGAGTTTGAAAAGATGACGAACAACAACAAAAAAGGGGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45483
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105496 Essential Splice Site 1177 1926 None 32
ENSDART00000124710 None 1208 1958 18 33
Genomic Location (Zv9):
Chromosome 13 (position 16493273)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16313308
GRCz11 13 16444300
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTTTAAACCTTCAGACTCAGCACATCGAGGACTGGCCCCCTGCTCTGC[A/G]GTAACAGCCGTCATGAAGAACCCTGTTTACATGGTGCGCAGTCACAGAGT
Long Flanking Sequence:
CCCAGTAGAAACCTACATGAATATGGGAAGAACATGCAAACTCCACACAGAGATGCCAACTGGCCCAATCGGGACTTGAACCAGCGACCTTCTTGCTGTGAGGTGACATTGCTAGCCACTTTGCCACCCCCAAACAAATATTCCAAAATTAAATTATGATTTAGTTATTCATGGGTTAATGTTTTATGTAATGAAAAACATTGTGAACTGTATCTATAAGTACATCTATTTATGCATTGATAAGTGATTTTAATTAATATATTTTTTATTAGTTAATATAACTTTAATAATAAGTGCTACATAACATTCAACGTATTAAACGTTTTTTGAACATGTGAGCAGGCCCAATAAAAGAAACTGAAATGAAATATGTGAGCACAGGGGGCAGTTGAAGGGAATTGTGTGTATGTGTGTTTCTCATTGGAGTGTTTTATTGGTTATTTTGTGGTTGTGTTTAAACCTTCAGACTCAGCACATCGAGGACTGGCCCCCTGCTCTGC[A/G]GTAACAGCCGTCATGAAGAACCCTGTTTACATGGTGCGCAGTCACAGAGTTCACACTAACAACTGCCCTACTGTCGTCAGCCAGATCAATCAGCAGCACACGCACCCCAGGTACCACAGTTCCCACTGAGATAACCAGCACTTCACACACATGCAAACTCAAACATATACTTCACTTCCTTTCTAGACTGTACCTTTATTACAGTGGAGAAGTAGACTTGACACATCCTTATCTGCTCCTTTATAAAACTGTGAGCCTGTTTTACAGAAACATGCAACAGAGATTATACATATTATTATGTACTAGCCATTCATTTACCAAAATAAGAAATATTTTGACATTTACATTTTTTACATTTTGGATCAAGTCTTTATTTCAACAGTGATTTGTTAAAATTTTAATTTATTTTAGAAAGAATCGAGTATTTATCAATTCTTGTCTCACCTCAATCACTCAGTTGCCCTGAGATTGTGTTTAAAGAAATGCAATATTTTTACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35447
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105496 Essential Splice Site 1255 1926 18 32
ENSDART00000124710 Essential Splice Site 1287 1958 19 33
Genomic Location (Zv9):
Chromosome 13 (position 16497559)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16317594
GRCz11 13 16448586
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCGGGCCTCACACGGCACCAACTCCCTGCCGTCCAGTGCAAGACTCGG[T/G]CAGTTTTCTTTAATAATACATGTTGTTGTCTGTTTACTCCACGCACCAAA
Long Flanking Sequence:
TTTTTTAAATAAAACTGCTAAAAATTCCTTGCTCTGTTAAAAAGATCGCTGGGGAAATATTTGAAAAAATCAACAAAACAAAAAATCACAGAATTCGCTAATAATTTTATATTCAACAGAATATCATACTATAAAAAATTTTGCGCTAAAAGTTTCTGTGGGCTGCCTTTCCTGAGCAGTTCCACTTATTTGTTTTGATTTCTCCACTTGATTCTATTCCAAAGTTTAATGAGCATAAGTGTGGTTTATAAGTGTGTCATACTAAGTGCAAACTAGCAGTTACAGGTGATAAACAGGCTAGTTATTCATTTTCTCACCCCATGATCATGAGTGTTTACTGATTCAGTGTGCTCAGTTTCTTCTCTCCATCTTAGTCCTCAGCATCAAGGACAACTGAGTCTGGACCTAAGCCAGAAACGCTCCACGGACTATTCTGAGTCGTCCCGTAGCAGCCGGGCCTCACACGGCACCAACTCCCTGCCGTCCAGTGCAAGACTCGG[T/G]CAGTTTTCTTTAATAATACATGTTGTTGTCTGTTTACTCCACGCACCAAACTTTCATATAAGTGTATTTTTATTTTGGTCTATATCTTCTCCCTTTTGCTTTCTGAAGGTTCATCAAACAACTTGCAGTATCGCACTGAAAGGATTAAGATTCCCTCCACACCGCGATATCCTCGCTCTATTCTGGGGTCAGACAGAGGTGAGTCTACTTTCATAAATAAAGGATTTCCGAATTCATGTGATATAAAGTGGAGATCAGAATTTGGTGAATTTACACTTCTAATTTGATTTGTTCAAATATCAAACATTTTTAGTTTTAGCTCATCAAACTGTGTTCTACAACAATTCCAAAGCCCCTTTGACAAAAATAACTGTTTTGTGAAAAACATAATCAAAAATTAAATACAGCAATAAGTATATGCATGGGGACTTTTAATTTTGAATAAGCCAGCTCAGGTGCTTCTGGTGAACAGTTACGCATTATAAACTCATCACATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13331
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105496 Nonsense 1410 1926 22 32
ENSDART00000124710 Nonsense 1442 1958 23 33
Genomic Location (Zv9):
Chromosome 13 (position 16512030)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16332065
GRCz11 13 16463057
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACATCAGTATAATGGAATAAACCTGCGYAATGCCACTGAACAGCAAGCA[C/T]GACTCATCATTGGCCAGCAGTGTGACACCATCACGATCATGGCCCAATAC
Long Flanking Sequence:
ATAATTACAATATCTTCAAAAAAGTTTATGTATTTCACTAATTCCATTCAAAAAGTGAAACTTGTATAATGTACATTCATTCCACACAGACTGATGTATTACAGGTGTTTATTTCTTTTAATTTTGATGACATCTAATGAAAACCCCAAAATGAATATTACTTAAAACCAATACAAAGAAGGGATTTTTAGACATTTTGGCCAACTGAAAAGTTAGAGTATGAGTAAAATATGTTTGTTTTTGCCTTTTTATATTTTCAATTATAATGAATAATGAATTTTAGATATGAGATATTTTAAATTGTGCTACTTTATTTAATAAAGCTAAGAAGTTTTTTAATTATATTACAACTAAATAATGGAAAACATGCACATATTTTTTTGATCATAGTAAAGCTGTATGCCATGTTATTGACAGTTTGCAATGTGTAACTTAAAGTTGTTCTTTCTTTACATCAGTATAATGGAATAAACCTGCGCAATGCCACTGAACAGCAAGCA[C/T]GACTCATCATTGGCCAGCAGTGTGACACCATCACGATCATGGCCCAATACAACCCACACATGTATCAGCTCGGCAACCACTCGCGCTCCAGGTACAATCCTTTCCCCATTTTATTCATTAAGCTAAATGCAGATTTGATGTATAGCTTTTAGTTTTTTTTCATGGCTGGCTTGTTTCATAGTTCCCGCCTGGAGCCAGTGAGCACTCAATCCACGCCACAGGGCAGTGGAACTGCAACCCCAGATAACCACTCTACCATAGACACCCTGAGTGAACAGGATGAAGGCACACTCACCCCATCCTCCAAACAGACCACACCCACAACCAGTCCCAACAGCTTCATCAGGTACTGCTCATACACTTAGAGAGCTGCCTTGTTGTGTACAGTCTTAGTAGGGGTGGGAACAGTGTTGGGTGTAATTGGTTACAAATGAACTACAAACTGTAATAAAATTATTAATTATTTTAATAAAATACATTTTATGCATTATTATTTATAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2723
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105496 Nonsense 1483 1926 23 32
ENSDART00000124710 Nonsense 1515 1958 24 33
Genomic Location (Zv9):
Chromosome 13 (position 16512339)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16332374
GRCz11 13 16463366
KASP Assay ID:
2260-6215.1 (used for ordering genotyping assays)
KASP Sequence:
TAGACACCCTGAGTGAACAGGATGAAGGCACACTCACCCCATCCTCCAAA[C/T]AGACCACACCCACAACCAGTCCCAAMAGCTTCATCAGGTACTGCWCATAC
Long Flanking Sequence:
TTTATTTAATAAAGCTAAGAAGTTTTTTAATTATATTACAACTAAATAATGGAAAACATGCACATATTTTTTTGATCATAGTAAAGCTGTATGCCATGTTATTGACAGTTTGCAATGTGTAACTTAAAGTTGTTCTTTCTTTACATCAGTATAATGGAATAAACCTGCGCAATGCCACTGAACAGCAAGCACGACTCATCATTGGCCAGCAGTGTGACACCATCACGATCATGGCCCAATACAACCCACACATGTATCAGCTCGGCAACCACTCGCGCTCCAGGTACAATCCTTTCCCCATTTTATTCATTAAGCTAAATGCAGATTTGATGTATAGCTTTTAGTTTTTTTTCATGGCTGGCTTGTTTCATAGTTCCCGCCTGGAGCCAGTGAGCACTCAATCCACGCCACAGGGCAGTGGAACTGCAACCCCAGATAACCACTCTACCATAGACACCCTGAGTGAACAGGATGAAGGCACACTCACCCCATCCTCCAAA[C/T]AGACCACACCCACAACCAGTCCCAACAGCTTCATCAGGTACTGCTCATACACTTAGAGAGCTGCCTTGTTGTGTACAGTCTTAGTAGGGGTGGGAACAGTGTTGGGTGTAATTGGTTACAAATGAACTACAAACTGTAATAAAATTATTAATTATTTTAATAAAATACATTTTATGCATTATTATTTATATGTATTTTAATTACAGTTTATGTGCATTTCTTAAATAAAAAAATAACTAAAAATGTTTATTTTTATCAAGATAATTACAAAAGCTTGAAGCAATGAGGTAAGTCAGATTTTTAAATGAAAATATAAGGTGTATTTTAGTAATAATTTAGGTTATTTATTTATAAGTATTTTTGCTATTTGAATATTTTGCATAATAACCCAATTTTTAAAGTAAAAGAGGTTACATTTGTCTGCTAAGTGCAGATGCTTAAGAAAATGTTATACATTTGTCAATATATGGTACGATTGAAATATTGTTTCATTAATTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22258
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105496 Essential Splice Site 1606 1926 25 32
ENSDART00000124710 Essential Splice Site 1638 1958 26 33
Genomic Location (Zv9):
Chromosome 13 (position 16522524)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16342559
GRCz11 13 16473551
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAGTTCAACCAGGTGAAAGGCACTCCTGGAGATGGATTCTATATCAGG[T/C]ACAGTATGATATCGCATCTGCCATTGACTTACATAAGCACACATGGCCGC
Long Flanking Sequence:
GACCTATAGGTTAGTGTATGCTCTGTCAGCCACATTGAGTGTTGTGTTTAATCAATAATTGATAAACTATTACGACTCAGATAATATTTTATCTAAAACAATATTTTCTGTCTAATTTGTGTCTAAGCCCTTCGGTCTTATATGACAGCCCTCCGAATTGCTTTAGGATTTACTCTGTGAAAACAACCTCCTGGATGTACTTAAAAAGCATGACTTTGGATTCTAGCAATGCATTGGTAACTGTTGAAATTAACAGTAAAATGAACCAATGAAACATTATAGTAAAGTGTGACCTATGTGTTTAAATTAAATGTAATAACCTCCTATTATATTATTATTTGTCCTTTCAGTATGGCTCAGTTAATATGAAGAATAAGACTGTGGAGGAGGCATATCTGGAAATGCTGAAGCCTGCAGAAACAGTGACGTTAAGAGTCCAGCATCGTCTGGATGAGTTCAACCAGGTGAAAGGCACTCCTGGAGATGGATTCTATATCAGG[T/C]ACAGTATGATATCGCATCTGCCATTGACTTACATAAGCACACATGGCCGCTTAAAAGTTCCATATAACCAAATACCAGAGTTTGGACCCTGCACTCACTGCTAAATATGGATACACGAGAAAATCGCATCAACGGGAATCTTTTAATCTTTTTAATTATGTTTAAGATGGAGGGTGAGATATTGTATCTGGCAGTGCAGATTGTATCACCAAATCTCCATAATTTGTGTTCTATAATAGTAGCTGTGGTAATTAGACGGTTCGAGACAGAGATGCATTGTGTCTGTGCGGTGGAAAAAAGAATAATGGAAGAGGGCTGTTCAGAAATAGCCATGTTTGTCTTCACAAATGAAATTCTGTGGCCCGCAGCTGTTGCAGGCGCTTTTTTCTGCCCGCTCTCCCATGATGTCACCCGCAGTAAATAATCTCTGTCAATCCGTGTGTCATGAATGAGCAGGAACGAGGAGTTATGGGTGGCTGCTAAAAGCCGCCTCGTGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12813
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105496 Essential Splice Site 1856 1926 30 32
ENSDART00000124710 Essential Splice Site 1888 1958 31 33
ENSDART00000105496 Essential Splice Site 1856 1926 30 32
ENSDART00000124710 Essential Splice Site 1888 1958 31 33
Genomic Location (Zv9):
Chromosome 13 (position 16532164)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16352199
GRCz11 13 16483191
KASP Assay ID:
2260-6217.2 (used for ordering genotyping assays)
KASP Sequence:
ATTTACCCAATCGTCATTTTCATACGCTACAAAAAYGCAAAGCAGATAAA[G/A]TAAGTTTTCACATCCTCCTYMACACATACMTATCAAAATAATCATAAACT
Long Flanking Sequence:
TCCTCTCGAAATTGGTTTATGAATAAACTTCACTTATGTCACCTAAAACAATTATTTGAGCCCTGATGTCAATTCCAGTAGTCATAGCAAAACATATGAATAAAGTGTAATTTTTCATTAGTTTTTTTTCTTATTCTCTAAAGCTAAAAACAATGGAAAAAATACTAAATTCTCAAAATATTTTTTTCTGCCTGAATTGACTAAATTAAGCTATTTTATCATTTTGTGTGAACTATCCCTTTAATAGTCAGATAAATCTCTTTTAAATAGAATAATATCAAGAGGCATTGTTAATGTTTGTTGATTTCGCTTTGCTGTTGTTTCTCTGTTGGCGTGTGCTGTATATGTGTAACATGACTCTGTTCTGTGCCATGTTGTTCTCTCTCATAGGACTGTCACTGTTTGCTTGACATTGCACCTCATGCTATTGAAAGGCTTCACAGCGTTCACATTTACCCAATCGTCATTTTCATACGCTACAAAAACGCAAAGCAGATAAA[G/A]TAAGTTTTCACATCCTCCTCAACACATACATATCAAAATAATCATAAACTGAATTCTTGGATGTCCTTGTGGACCCTTCCAAACACACATACACGCGCACACACTCTGTTCAAGGCCTTCTTGGCACATTTTTATGCCAAGAAGTTCCTGTGCGCTCCCCCAGGGCCCTGAAGACATTTGGGAAATGGAAAGCAGTTTTACTGTGTAGGCTGCGTTTGACTTGGAAGAACTGCTGTTAAACGGATGAATATCTTGTCTCCCTTTATATAGATATAGGACAAGATATATGGCAGCGTAGGCAGCCGCTTCACTCTTTCTGTCTGTGCCTCCTTCTTTGGTTGTCTGCTGAAGGTCACTTTGTGAGATTCCAGACCTGGTTTATCAGACAGGCTCAGTTAAAGGGGATATGTCACAAGAATTTGATTTTTCCATGTTTGATTGCTATAATAGGTTCCCTGATGCATCTACCAACCCAGAGACTGGCTGCAGCAGATAGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15456
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105496 Essential Splice Site 1856 1926 30 32
ENSDART00000124710 Essential Splice Site 1888 1958 31 33
ENSDART00000105496 Essential Splice Site 1856 1926 30 32
ENSDART00000124710 Essential Splice Site 1888 1958 31 33
Genomic Location (Zv9):
Chromosome 13 (position 16532164)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16352199
GRCz11 13 16483191
KASP Assay ID:
2260-6217.2 (used for ordering genotyping assays)
KASP Sequence:
ATTTACCCAATCGTCATTTTCATACGCTACAAAAAYGCAAAGCAGATAAA[G/A]TAAGTTTTCACATCCTCCTYMACACATACATATCAAAATAATCATAAACT
Long Flanking Sequence:
TCCTCTCGAAATTGGTTTATGAATAAACTTCACTTATGTCACCTAAAACAATTATTTGAGCCCTGATGTCAATTCCAGTAGTCATAGCAAAACATATGAATAAAGTGTAATTTTTCATTAGTTTTTTTTCTTATTCTCTAAAGCTAAAAACAATGGAAAAAATACTAAATTCTCAAAATATTTTTTTCTGCCTGAATTGACTAAATTAAGCTATTTTATCATTTTGTGTGAACTATCCCTTTAATAGTCAGATAAATCTCTTTTAAATAGAATAATATCAAGAGGCATTGTTAATGTTTGTTGATTTCGCTTTGCTGTTGTTTCTCTGTTGGCGTGTGCTGTATATGTGTAACATGACTCTGTTCTGTGCCATGTTGTTCTCTCTCATAGGACTGTCACTGTTTGCTTGACATTGCACCTCATGCTATTGAAAGGCTTCACAGCGTTCACATTTACCCAATCGTCATTTTCATACGCTACAAAAACGCAAAGCAGATAAA[G/A]TAAGTTTTCACATCCTCCTCAACACATACATATCAAAATAATCATAAACTGAATTCTTGGATGTCCTTGTGGACCCTTCCAAACACACATACACGCGCACACACTCTGTTCAAGGCCTTCTTGGCACATTTTTATGCCAAGAAGTTCCTGTGCGCTCCCCCAGGGCCCTGAAGACATTTGGGAAATGGAAAGCAGTTTTACTGTGTAGGCTGCGTTTGACTTGGAAGAACTGCTGTTAAACGGATGAATATCTTGTCTCCCTTTATATAGATATAGGACAAGATATATGGCAGCGTAGGCAGCCGCTTCACTCTTTCTGTCTGTGCCTCCTTCTTTGGTTGTCTGCTGAAGGTCACTTTGTGAGATTCCAGACCTGGTTTATCAGACAGGCTCAGTTAAAGGGGATATGTCACAAGAATTTGATTTTTCCATGTTTGATTGCTATAATAGGTTCCCTGATGCATCTACCAACCCAGAGACTGGCTGCAGCAGATAGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13023
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105496 Essential Splice Site 1856 1926 30 32
ENSDART00000124710 Essential Splice Site 1888 1958 31 33
ENSDART00000105496 Essential Splice Site 1856 1926 30 32
ENSDART00000124710 Essential Splice Site 1888 1958 31 33
Genomic Location (Zv9):
Chromosome 13 (position 16532164)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16352199
GRCz11 13 16483191
KASP Assay ID:
2260-6217.2 (used for ordering genotyping assays)
KASP Sequence:
ATTTACCCAATCGTCATTTTCATACGCTACAAAAAYGCAAAGCAGATAAA[G/A]TAAGTTTTCACATCCTCCTYMACACATACMTATCAAAATAATCATAAACT
Long Flanking Sequence:
TCCTCTCGAAATTGGTTTATGAATAAACTTCACTTATGTCACCTAAAACAATTATTTGAGCCCTGATGTCAATTCCAGTAGTCATAGCAAAACATATGAATAAAGTGTAATTTTTCATTAGTTTTTTTTCTTATTCTCTAAAGCTAAAAACAATGGAAAAAATACTAAATTCTCAAAATATTTTTTTCTGCCTGAATTGACTAAATTAAGCTATTTTATCATTTTGTGTGAACTATCCCTTTAATAGTCAGATAAATCTCTTTTAAATAGAATAATATCAAGAGGCATTGTTAATGTTTGTTGATTTCGCTTTGCTGTTGTTTCTCTGTTGGCGTGTGCTGTATATGTGTAACATGACTCTGTTCTGTGCCATGTTGTTCTCTCTCATAGGACTGTCACTGTTTGCTTGACATTGCACCTCATGCTATTGAAAGGCTTCACAGCGTTCACATTTACCCAATCGTCATTTTCATACGCTACAAAAACGCAAAGCAGATAAA[G/A]TAAGTTTTCACATCCTCCTCAACACATACATATCAAAATAATCATAAACTGAATTCTTGGATGTCCTTGTGGACCCTTCCAAACACACATACACGCGCACACACTCTGTTCAAGGCCTTCTTGGCACATTTTTATGCCAAGAAGTTCCTGTGCGCTCCCCCAGGGCCCTGAAGACATTTGGGAAATGGAAAGCAGTTTTACTGTGTAGGCTGCGTTTGACTTGGAAGAACTGCTGTTAAACGGATGAATATCTTGTCTCCCTTTATATAGATATAGGACAAGATATATGGCAGCGTAGGCAGCCGCTTCACTCTTTCTGTCTGTGCCTCCTTCTTTGGTTGTCTGCTGAAGGTCACTTTGTGAGATTCCAGACCTGGTTTATCAGACAGGCTCAGTTAAAGGGGATATGTCACAAGAATTTGATTTTTCCATGTTTGATTGCTATAATAGGTTCCCTGATGCATCTACCAACCCAGAGACTGGCTGCAGCAGATAGAGAT
Associated Phenotype:
Not determined