Busch Lab

ZMP

si:ch211-227i14.2

Ensembl ID:
ENSDARG00000074040
ZFIN ID:
ZDB-GENE-081104-186
Description:
Novel protein similar to vertebrate E1A binding protein p400 (EP400) [Source:UniProtKB/TrEMBL;Acc:B0
Human Orthologues:
EP400, EP400NL
Human Descriptions:
E1A binding protein p400 [Source:HGNC Symbol;Acc:11958]
EP400 N-terminal like [Source:HGNC Symbol;Acc:26602]
Mouse Orthologue:
Ep400
Mouse Description:
E1A binding protein p400 Gene [Source:MGI Symbol;Acc:MGI:1276124]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa38707 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa27259 Nonsense Mutation detected in F1 DNA Not yet available
sa21364 Nonsense Available for shipment Available now
sa21365 Essential Splice Site Available for shipment Available now
sa5775 Nonsense F2 line generated Not yet available
sa1673 Essential Splice Site F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5504
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111655 Nonsense 262 3108 2 63
ENSDART00000138261 None None 184 None 3
ENSDART00000145142 Nonsense 284 1616 1 24

The following transcripts of ENSDARG00000074040 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 46416399)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43727090
GRCz11 8 43720509
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACCACCACCAAKCTGCCACCTCAGATCAGTAGCATYATCCAAGGCCAGT[T/A]AGCCCGACCCACCATGTTTGAGAAGACAAGTCAAAGTNNNGTCGGCGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38707
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111655 Essential Splice Site 415 3108 3 63
ENSDART00000138261 None None 184 None 3
ENSDART00000145142 Essential Splice Site 437 1616 2 24

The following transcripts of ENSDARG00000074040 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 46419676)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43723813
GRCz11 8 43717232
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTATTTTCTGTGGCTTTGTATCTTTCATCTGTTTCTATGACAACCTCTC[A/G]GGTGAAAGTAGTGACTGGAAAGGATGGACAGACAGTGACTCCGGTTGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27259
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111655 Nonsense 876 3108 12 63
ENSDART00000138261 None None 184 None 3
ENSDART00000145142 Nonsense 898 1616 9 24

The following transcripts of ENSDARG00000074040 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 46427789)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43715700
GRCz11 8 43709119
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAGCATCATTTTGAGATCTACGACAAACAAAAAAAAGTTCTCTGCTTG[C/T]AGAAGGCTTCGAGTAAAGGTGAGATTGAGAAATGAAAACTTTATGGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21364
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111655 Nonsense 1667 3108 29 63
ENSDART00000138261 None None 184 None 3
ENSDART00000145142 None None 1616 None 24

The following transcripts of ENSDARG00000074040 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 46441714)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43701775
GRCz11 8 43695194
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCACACCACCACAAGGTGAGGCACTGCTCCGTTCTGAAGCTGATTTTTA[T/G]CTTCATGTGGGTTGGCCAACAAGGTTTTTGAAAACTAGGCCCAGCAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21365
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111655 Essential Splice Site 2200 3108 39 63
ENSDART00000138261 None None 184 None 3
ENSDART00000145142 None None 1616 None 24

The following transcripts of ENSDARG00000074040 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 46453268)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43690627
GRCz11 8 43684046
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGACGAAGAGGATCTGCTCTCCTATACTAGAGAGGATGCATACAACATG[G/A]TACAAATATATTTTAGCTAGTTGTTGTGTAAAATATGATGTGGCATAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5775
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111655 Nonsense 2509 3108 47 63
ENSDART00000138261 None None 184 None 3
ENSDART00000145142 None None 1616 None 24
ENSDART00000111655 Nonsense 2509 3108 47 63
ENSDART00000138261 None None 184 None 3
ENSDART00000145142 None None 1616 None 24

The following transcripts of ENSDARG00000074040 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 46456757)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43687138
GRCz11 8 43680557
KASP Assay ID:
554-3480.1 (used for ordering genotyping assays)
KASP Sequence:
AGCAGGCACTAGCCGAACAGCAGAGGGCTCAGCAGTTAGCCCAACAGCAG[C/T]AGCAGACCACAGGMGCYGCTCAGCCTCAGGGAGCAGCAGCACAGCCYCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2466
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111655 Nonsense 2509 3108 47 63
ENSDART00000138261 None None 184 None 3
ENSDART00000145142 None None 1616 None 24
ENSDART00000111655 Nonsense 2509 3108 47 63
ENSDART00000138261 None None 184 None 3
ENSDART00000145142 None None 1616 None 24

The following transcripts of ENSDARG00000074040 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 46456757)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43687138
GRCz11 8 43680557
KASP Assay ID:
554-3480.1 (used for ordering genotyping assays)
KASP Sequence:
AGCAGGCACTAGCCGAACAGCAGAGGGCTCAGCAGTTAGCCCAACAGCAG[C/T]AGCAGACCACAGGMGCYGCTCAGCCTCAGGGAGCAGCAGCACAGCCYCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1673
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111655 Essential Splice Site 2573 3108 48 63
ENSDART00000138261 None None 184 None 3
ENSDART00000145142 None None 1616 None 24

The following transcripts of ENSDARG00000074040 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 46457847)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 43686048
GRCz11 8 43679467
KASP Assay ID:
554-1619.1 (used for ordering genotyping assays)
KASP Sequence:
AAGACTGGAGCCCTCAAGACTGCTGCAGCAGGCACAAGCATCCAGCCAGG[T/G]ATCATCACATTACACRTTTTTTCTGTACTTGTTTGTACTATTTATGTATT
Associated Phenotype:
Not determined