Busch Lab

ZMP

si:dkey-91i10.2

Ensembl ID:
ENSDARG00000074034
ZFIN ID:
ZDB-GENE-050208-441
Description:
guanine nucleotide exchange factor [Source:RefSeq peptide;Acc:NP_001153137]
Human Orthologues:
AKAP13, ARHGEF18, ARHGEF2, RP11-428C6.1
Human Descriptions:
A kinase (PRKA) anchor protein 13 [Source:HGNC Symbol;Acc:371]
Rho-guanine nucleotide exchange factor [Source:UniProtKB/Swiss-Prot;Acc:Q8N1W1]
Rho/Rac guanine nucleotide exchange factor (GEF) 18 [Source:HGNC Symbol;Acc:17090]
Rho/Rac guanine nucleotide exchange factor (GEF) 2 [Source:HGNC Symbol;Acc:682]
Mouse Orthologues:
Akap13, Arhgef18, Arhgef2, Rgnef
Mouse Descriptions:
A kinase (PRKA) anchor protein 13 Gene [Source:MGI Symbol;Acc:MGI:2676556]
Rho-guanine nucleotide exchange factor Gene [Source:MGI Symbol;Acc:MGI:1346016]
rho/rac guanine nucleotide exchange factor (GEF) 18 Gene [Source:MGI Symbol;Acc:MGI:2142567]
rho/rac guanine nucleotide exchange factor (GEF) 2 Gene [Source:MGI Symbol;Acc:MGI:103264]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa41409 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2534
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113475 None None 599 None 5
ENSDART00000133676 Nonsense 326 1093 1 6
Genomic Location (Zv9):
Chromosome 9 (position 23996265)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23152051
GRCz11 9 22962920
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGCAAAGGGAGAGCAGTAAGAACCACAGCTCCTCRGAAATGGAGAGTTG[C/A]GACAGGCCAAGTGAGGACACACAGAATCCAGAAAGGACTGCCAATAACGT
Long Flanking Sequence:
CTTTTACCTGCGGTTGAGGACTGGGGCATGAATGGAAATGCCCGAAAGGGTCTTCGGGATAAGCTGAGACTCCAGAGCACACGCGTAGCGGAGCCCATTAAACCTGTGCGCCCTCAGCCTGTGCTCGGAAATGCACCGTCTCTAATGCATCAGGATGTAGCAGTTCAGCCAGGGCTGGCGTTCTTACAAAAAAATGGACAGCGAGAGTTGAGTGCCCGTCGCATCACAAGTCCCGAGGAGATCAAACAAGAAGCGATGCGACGACTTCAGCTACGCAGGCAAAGGAGCACCCCTAACCTGGCACTGACCTGCAGACAGGAGTCTAGTGCCCTGAGTAAAGCTCAAACTGCAGAACTTATCTGCACTAACTCTGCTCAGTCAACCCCAGAGAGGAAAAGACCTCCGATGGGCCGCCTGCACATACCCACATTTGAGGAGTTTAAGAGGATGAGGCAAAGGGAGAGCAGTAAGAACCACAGCTCCTCAGAAATGGAGAGTTG[C/A]GACAGGCCAAGTGAGGACACACAGAATCCAGAAAGGACTGCCAATAACGTCAGAACCACTCTGGATTCGGCTGGTGGACCCAGTGGAGGGGAGATGTCTGAGCTCATTTCCACCACAGTGGTCCCAGGAGGACCCATCTGCACAGGGCCAGTAGCCCGCTCTCCATTACATCCTCAAGCCGCTGCAGGAAAAGAGGAAGAGACAAAGGGCCCAGCAGGCCCTGGGGCCACAGATGTAGCTGTTCTTCCTTTCCCGCCCCGCAGGGAGAGCGGTGATGTCCCATCCAGCTGCTGCCAAGCAATCCTTCTTGATGGCACAGACCTCTCCAGCTATGGAGCCAAAATTTACAAAATGAGGGATGGCTTTCTAGGATCTGCCCTGGACCTTATTAAAAAAAGGTGAGTGGATGAAGGAGCTGTTGTGTTTATACCGGAACATTTGTGAGTGATGTACATTTGCCTAGCACTTACAGTTAAAATAGTGACAGATCATTTCAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41409
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113475 Nonsense 40 599 2 5
ENSDART00000133676 Nonsense 533 1093 3 6
Genomic Location (Zv9):
Chromosome 9 (position 23982740)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23138526
GRCz11 9 22949395
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCAGGTTTCAGGGCCGGGCTGCAGACGCTCCAGCTCAGACGCGGCCTA[T/A]GAGCTGGCGGAGTCTGTTAAGGCCCAGCGTGAGTGTCGTCTGCGGCCCCA
Long Flanking Sequence:
ACTAATTGCAATGCGACAGTATGTAATCACAACCCATTTGCTCATGCTTATTGAGCAAGCTCATACACAAAAAAAGTGAAACAAATGAGGAGGATTGTGGACATAAAATCTAAATCAAGTCATTTTAACATGTCAAAGTCAAATTTATGCATATAAAATATATTTTCCCAACAACAAAATTGTGGCTTGTGAAAATGCTAAGTGGCTAGTAAACTTATAGCTATGAACTGTCCACTTACCAGTTCAACATATTAAAAGGCATCGGTAATGTTACACCCTCTGGACATTGTGGAATTCAGTGATCGATGTCTGAAGCTGTTAGTGGTGTCTTCAATTCTCATTTGTGCTTAGAGATCAGATCTGCCTTCACTGAGGTTTTACACTGTCACATGCATATCTGAGAGCAGCGTTCTGCCATGTGTACAGCCGTCTAACAGATCTCCATCCCGTTGGCAGGTTTCAGGGCCGGGCTGCAGACGCTCCAGCTCAGACGCGGCCTA[T/A]GAGCTGGCGGAGTCTGTTAAGGCCCAGCGTGAGTGTCGTCTGCGGCCCCACTACAGCGACCCCATGCCTGCAGATGCCACCAAGCGGAAGCAGCTGGAGATGAAGATCGCCGCCGCCGCACGCTTGCACATTCACCGCAGAGACAGAGACACTGGTACAACTCAACTCATGTCCTAGTTTGCACTGAGATTATTTCATTGAAAACATTTTAGGCTTGTCTGTAACCCAAGGGTATCACTTTAGTTGTGATTATGCCTCCGTTATTAATAATACTTGGCCGTGGGTGGCATTTATAGTGCCGTCACATGCATAACCTCTACCCTGGAGACTGCTCTTATTTTTCTGCATCATGGCAGCTGGATTCAGTGTGCATATTTGTTTTAGACTTTTAGACAACTCTTTAATGCGTAGAATATTTTAACCCTGTAAGACCTGACATGTCAAAAAAATAGGCAGAAAATTCACATTTTCCGGAACTGAGATGTTTATTAAACTGTCTA
Associated Phenotype:
Not determined