Busch Lab

ZMP

si:dkey-202m22.5

Ensembl ID:
ENSDARG00000074030
ZFIN ID:
ZDB-GENE-030131-3885
Human Orthologue:
MYT1
Human Description:
myelin transcription factor 1 [Source:HGNC Symbol;Acc:7622]
Mouse Orthologue:
Myt1
Mouse Description:
myelin transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1100535]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa24368 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4218
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114628 Essential Splice Site 850 1156 14 21
ENSDART00000131285 None None 126 None 6
ENSDART00000135771 Essential Splice Site 856 1162 16 23
ENSDART00000136156 None None 57 None 6
Genomic Location (Zv9):
Chromosome 23 (position 31012133)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30847023
GRCz11 23 30773554
KASP Assay ID:
2261-7978.1 (used for ordering genotyping assays)
KASP Sequence:
AAACCTAYTTCCTTCTATTCTTTCCTCCTGGTGTTTTTCTACTGCTCTTC[A/G]GTCTCTCTGGTTGTCCCCTTGCTGATAAAAGTCTTCGGACCCTCATGGCT
Long Flanking Sequence:
GGCCTTAAATTTCCATAAATTGATTTATCAACTTTTAATACTTTTTAAGACCCCGCGGACACCCTTTTTTTTTTTGATAGTCTACAGAACAAACATACAACAACTTGCCTAATTACCCTAGCCTGCATAGTTAACCTAATAAACCTAGTTAAGCCTTTAAATGTCACTTTAAGCAGTATAGAAGTGTCTTGAAAAATATCTAGTCAAATATTTTTTACTGTCATCATGGCAAAGATAAAAGAAATCAGTTATTAGAAATGAGTTATTAAAACGATTATGTTTATAAATGTGTTTAAAAAAATTCTCTCCGTTAAACAGAAATTGGGGGGAAAATAAACAGGGGGGCTAATAATTCAGGGGGTTTAATCATTTTGACTTAAAACTGTATATTGCTAAAATACAGAGTTTGCATTATACTACACAATACATATAACTCTTCCATCTTCAATTAAACCTACTTCCTTCTATTCTTTCCTCCTGGTGTTTTTCTACTGCTCTTC[A/G]GTCTCTCTGGTTGTCCCCTTGCTGATAAAAGTCTTCGGACCCTCATGGCTGCCCACACTGCTGAACTCAAGTATGTCTGTGCTCTGATTTTTCCTCTAATGAATGACCTCTACTGATTACTACTTGCACTTTGCTGAACACTGCTGTTCCTGTAATACACTGTTTACTGTCTCTTTTGCTGGCTGTTCTTGCACTAAATGAACCAGAAATCACTTTACATTTACACTGGTCAAAGATTTTGCTGGACTGTGTATTGAAGATGCAGCAAACCAAATTAAACATATATTAAGTATCCAGACTGAAACCCAAATATTAATTTAAAGATATAATATAAACGAATGGGTGATATTTAAATTATATTTCTCTGAAGGTGTACTGTTTGTAGCAATGCTAACCTGTCTTTCTCTCTTTTTTTGTGAATTCCAGATGCCCTACCCCAGGTTGTGATGGATCAGGACACATCACTGGAAACTATGCTTCCCATAGAAGGTTTGTTAGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29960
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114628 Essential Splice Site 894 1156 16 21
ENSDART00000131285 None None 126 None 6
ENSDART00000135771 Essential Splice Site 900 1162 18 23
ENSDART00000136156 None None 57 None 6
Genomic Location (Zv9):
Chromosome 23 (position 31011546)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30846436
GRCz11 23 30772967
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCAAACTGTGCATATTGAAACACAGTAACATTTACATGTTATCTTTTGC[A/T]GTCTGTCTGGATGTCCACGTGCCAAGAAGGGAGGAATCAAAACCACCCCG
Long Flanking Sequence:
ATTTTTCCTCTAATGAATGACCTCTACTGATTACTACTTGCACTTTGCTGAACACTGCTGTTCCTGTAATACACTGTTTACTGTCTCTTTTGCTGGCTGTTCTTGCACTAAATGAACCAGAAATCACTTTACATTTACACTGGTCAAAGATTTTGCTGGACTGTGTATTGAAGATGCAGCAAACCAAATTAAACATATATTAAGTATCCAGACTGAAACCCAAATATTAATTTAAAGATATAATATAAACGAATGGGTGATATTTAAATTATATTTCTCTGAAGGTGTACTGTTTGTAGCAATGCTAACCTGTCTTTCTCTCTTTTTTTGTGAATTCCAGATGCCCTACCCCAGGTTGTGATGGATCAGGACACATCACTGGAAACTATGCTTCCCATAGAAGGTTTGTTAGTCATCATTTTACATTCACTCCTCCAAAGTTCCAAAAATATCAAACTGTGCATATTGAAACACAGTAACATTTACATGTTATCTTTTGC[A/T]GTCTGTCTGGATGTCCACGTGCCAAGAAGGGAGGAATCAAAACCACCCCGACAAAGGATGACAAGGAAGACTCTGAGCTCATAAAGTACGTTTTTAATAAACCTACTATGCTGCACAAAGCCAGCGGATTTACTAAACACAGCCTGCGTCTTTAGAGAATGCCAAAACTGACTGCCAGCTCATCACTTACCTCTCTATAGGTGCCCGGTGCCAGGTTGTGACAGTCTGGGGCATATCAGTGGGAAATACGCCACCCACCGCAGTGCCTATGGGTGCCCGCTGGCAGCACGCCGGCAGAAAGAGGGCATGTTAAATGGCACACCATTCTCCTGGAAGGCCTTCAAGACTGAGGGCCCGACCTGCCCCACGCCGGGATGTGATGGATCAGGACATGCCAATGGCAGCTTCCTCACTCATCGCAGGTACAGATGGAGCCTAGTGAAATTTGCAGATATATATTAGGGTTCTGTATTGAAAACAGAGAAAGGAGGAACATATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24368
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114628 Essential Splice Site 1026 1156 18 21
ENSDART00000131285 None None 126 None 6
ENSDART00000135771 Essential Splice Site 1032 1162 20 23
ENSDART00000136156 None None 57 None 6
Genomic Location (Zv9):
Chromosome 23 (position 31008919)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30843809
GRCz11 23 30770340
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGTTCCCAGGAGATGACTACATCAGCAAGAAATTCAGGGCAAGTGATG[G/A]TAAGATCAAATATCATCTGCTTCTCTTATTGTGTCCAATTATGTTTATTT
Long Flanking Sequence:
GCTGTTGTGCCTATATTCATTGCACAGACCGATTTACGGTTTTATTGTTATTATCACACGAAGGCTATTTCTTATCATCTGGATAATTTTTATTAGCATATTGCAAATGATAAGATATATTGCTTATCTTTAATTTGAGTGTTAATATAGCTATCATTTCCTTTATCGTTGTACAGAAGTTATCACTCTTAGACTAATATATATGTGAGCGAATTAAACTATGCGATCATTTTCGTGAGCAAACTTTATATATTTTTTTGATAGAATTTTGACTGAAGCTATTTTCCTTAGAAATGTCATACTGAGATGTTTTGAAATATTAGAAATGTCTATTTTTGACTTGCTGGGGTTATTGGGGGCTGATGTAAGTCTTGTTTCATATCTCATAATCATGGTGTGTTTCCACAGCCTGTCAGGTTGCCCTAGAGCTTCAGCTAACAAGAAGAGAGCCAGGTTCCCAGGAGATGACTACATCAGCAAGAAATTCAGGGCAAGTGATG[G/A]TAAGATCAAATATCATCTGCTTCTCTTATTGTGTCCAATTATGTTTATTTTGCACTTTTGATTAACTTATGCAGTTTTTTTATCCATTCAGTGCTAGACAATGATGAAGATATTAAACAGCTAAACAAAGAGATCAATGAACTGAATGAGTCGAACTCTGAGATGGAAGCAGACATGGCCAACCTCCACACACAGGTCTGCTTTCATCAAATACATATATGCTCTGCTATACAAAGGTTTGGGATCGGTGGGGTTTTGAAAATGTTTTAAAAGACAACGTTTAGCCTATCTGCATTTAATTAAAAAATACAGTAAAAATGGTATTGTTTGTACAGACATTTGAGCCCATTAATGAGTCTAATTATTCACTGATGTAAATGTGTGTAAATATATATTTATTCAGTTTCCATATTAATTTCAGTAGATTAATAGTACAGTAGTAGGGCTGCACGATTACTAAAAAAAAAGATTGTGATCTTGATTACAAGCATTTAATGTTT
Associated Phenotype:
Not determined