Busch Lab

ZMP

wu:fb11h05

Ensembl ID:
ENSDARG00000074009
ZFIN ID:
ZDB-GENE-030131-8437
Description:
Wu:fb11h05 protein [Source:UniProtKB/TrEMBL;Acc:A9JRP2]
Human Orthologues:
ZNF200, ZNF660
Human Descriptions:
zinc finger protein 200 [Source:HGNC Symbol;Acc:12993]
zinc finger protein 660 [Source:HGNC Symbol;Acc:26720]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa44592 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44592
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110358 Nonsense 308 390 3 3
Genomic Location (Zv9):
Chromosome 4 (position 28128317)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 28866123
GRCz11 4 28820766
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAACACCACATGATAAGTCACACCGGGGAGAAGCCGTTTACATGTGCT[C/T]AGTGTGGAAAGAGCTTCACAACCAAAGCTAGCCTCATGAACCACATGAAT
Associated Phenotype:
Not determined