Busch Lab

ZMP

slc6a11

Ensembl ID:
ENSDARG00000074002
ZFIN ID:
ZDB-GENE-030131-3729
Description:
solute carrier family 6 (neurotransmitter transporter, GABA), member 11 [Source:RefSeq peptide;Acc:
Human Orthologues:
SLC6A11, SLC6A12, SLC6A13
Human Descriptions:
solute carrier family 6 (neurotransmitter transporter, GABA), member 11 [Source:HGNC Symbol;Acc:1104
solute carrier family 6 (neurotransmitter transporter, GABA), member 13 [Source:HGNC Symbol;Acc:1104
solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 [Source:HGNC Symbol;
Mouse Orthologues:
Slc6a11, Slc6a12, Slc6a13
Mouse Descriptions:
solute carrier family 6 (neurotransmitter transporter, GABA), member 11 Gene [Source:MGI Symbol;Acc:
solute carrier family 6 (neurotransmitter transporter, GABA), member 13 Gene [Source:MGI Symbol;Acc:
solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 Gene [Source:MGI Sym

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa40760 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13047 Nonsense Available for shipment Available now
sa15368 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40760
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103757 Essential Splice Site 222 590 5 14
Genomic Location (Zv9):
Chromosome 6 (position 40565518)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40637118
GRCz11 6 40634654
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATCCTGGTCTACTTCTGCATCTGGAAAGGCGTGAAATCAACTGGCAAG[G/A]TTACACTTCTAACATACAGCAATACAATCATTTTAATTTATTTTTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13047
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103757 Nonsense 295 590 7 14
Genomic Location (Zv9):
Chromosome 6 (position 40565979)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40637579
GRCz11 6 40635115
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTCRTATGCCATTTGTCTGGGTTACCTCAGCTCTCTTGGAAGCTACAAT[C/T]AATATAATAATAACTGCTACAGGTGAATGTWCATTTKAATTRAACAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15368
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103757 Essential Splice Site 382 590 10 14
Genomic Location (Zv9):
Chromosome 6 (position 40570389)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40641989
GRCz11 6 40639525
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCATCCCCTGTTCCTGYCTTCCCATYCAATGTCTTTTCTTTTGTTAYTC[A/C]GTTTGTAGGACTGGAGAGTATAATGACATCAGTGACAGACWTATTTCCCA
Associated Phenotype:
Not determined