Busch Lab

ZMP

srpk1a

Ensembl ID:
ENSDARG00000073997
ZFIN ID:
ZDB-GENE-030131-2399
Description:
serine/arginine-rich protein specific kinase 1a [Source:RefSeq peptide;Acc:NP_955944]
Human Orthologue:
SRPK1
Human Description:
SRSF protein kinase 1 [Source:HGNC Symbol;Acc:11305]
Mouse Orthologue:
Srpk1
Mouse Description:
serine/arginine-rich protein specific kinase 1 Gene [Source:MGI Symbol;Acc:MGI:106908]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa21285 Essential Splice Site Available for shipment Available now
sa21286 Essential Splice Site Available for shipment Available now
sa9382 Nonsense Mutation detected in F1 DNA Not yet available
sa21287 Essential Splice Site Available for shipment Available now
sa15574 Nonsense Available for shipment Available now
sa21288 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21285
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037109 Essential Splice Site 197 634 7 16
Genomic Location (Zv9):
Chromosome 8 (position 24720442)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23846260
GRCz11 8 23867499
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAACTATCAAGGCTTACCTCTGCCCTGTGTGAAGAGCATCATTCGACAG[G/A]TAATTCAACACACCACCACACAACCAGATCAGTCTTCACCTAATTACCAT
Long Flanking Sequence:
TATTATATTATATTATATTATATTATATTATATTATATTATATTATATTTTATGTATGAATGTATGTGCAATTTTCTTTATTTTGTTTTCAGGTCAGAAATACAGACCCTGATGATCCAAACAGAGAGATGGTTGTGCAGCTACTGGATGATTTCAAGATCTCAGGGGTCAATGGCACTCGTATCCTTGAAAATGCACAATGTTGTTGTGAGTGTGAAAGAGAAAATGGGTCAGGAAGTCTTCTAAGCAGTCGTCTCGTGCTATTTTAGCATACCCTAAATTCTTTTACAGAAACGCTGACTTTAAAACGGTTGTTTTCGAGATCCTGTTTTGCAGATAGATTTTTGAACATGTAATTTTGCCAACAGCAGATTCCTTTACTTGAAGTTTTAGATGTCTGCATGGTGTTTGAAGTTCTAGGGCACCACTTGCTTAAATGGATTATCAAGTCCAACTATCAAGGCTTACCTCTGCCCTGTGTGAAGAGCATCATTCGACAG[G/A]TAATTCAACACACCACCACACAACCAGATCAGTCTTCACCTAATTACCATGTAGCTAATTAGCCTCTGTCCTGGATCCGGTGGATCTGTTACAGATTAATTATTGTTTGCACTTGTTTTGTGTTTATGCTTTTATGAATAAAAATTGCTAATGAAAACACTGAGGTGGAGGAAAAAACATGATAACAGGGCATGATGTACATTATTTAACATTTTTTAGTAAGTATTATTTTTTTTAAATAATATTTTTATTTGTGTGTATTAAAGTGAGTATTAAATTTATACAGAGACAACATTTTGAAACATTAATAATATTAAAAAGTTTAATTAATCTTAACTTTGTCATCAAAGTAATCAGTTTTCACAAGACATTAAACAGCATAACTGTAAACAGCAAACCAGTTTAAAACAATGATATTAATAATGAAAATCTTTTTAAAGTTGCAAATCTATATTACAGTAATTTCTGACACATTATGTGACTGTAATGGTTGCTGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21286
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037109 Essential Splice Site 253 634 8 16
Genomic Location (Zv9):
Chromosome 8 (position 24721613)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23847431
GRCz11 8 23868670
KASP Assay ID:
2260-0565.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCACTGAATGGCAGAAAGCAGGAGCTCCTCCTCCATCTGGATCAGCAGG[T/C]ATAGCAGTTCTGCTTTCTCACATATGACTGTGTGTCAACTTCTTCTTACT
Long Flanking Sequence:
TTATATATTGCTTTATCTTCTCCCTTCTTTGTCTCTGATACTTTTTTGCGCTTTATTTAGACACTTTGCGTATGCATTTTGTTTGTTAATATTTTATAGCATATTTTAATGTTGTTTTAAAGTTATGCTTATTCCTAGAATTGTTATAAAAACCAAAAAACTTTTAGTAACACATTTTTATTGTTCTGAAAGGCCATTAATGACCAACACAATCAATAAATAATGTTATTTAGCACTGAATAATAATTATTTTAAATTATGAGCCTTAATGTTATGTTCTCTTATGTTTAGAAAGATGCTAATGTTTGATATGTCTTTTACCTAATCTCTAAGGTTCTTCAGGGTCTGGATTACCTGCACACCAAGTGTCAAATCATCCACACAGACATTAAGCCAGAGAACATTCTGATGAGCGTGGAGGAGCTGTATGTCAGGCGACTGGCCGCAGAAGCCACTGAATGGCAGAAAGCAGGAGCTCCTCCTCCATCTGGATCAGCAGG[T/C]ATAGCAGTTCTGCTTTCTCACATATGACTGTGTGTCAACTTCTTCTTACTATATTTTTGGTTGATCACACACTCATGTTAACACAACTTGTTGGTTAAGTTTTCTTACCCTCAAGCATGCTGCTTATAAAGGGACAATTGATTTGTTTTTGTTAGCAGTCTCTGTGTCTCAGTTTCTTTTTTTTTATCTTCCAGTGAGCACTGCGCCTGCACCAAAACAGGTATGCTTTCCTCCTTTAACAAATACTTTTACACTATGTATTTTAGAAAATGAAATATACCCGAAGAAAACTTATTCAGAGAGTCAAGCTGATTCTTTAGTGCACTGAAGCTGGTTTGCAAAAGCTGATCTTTGTTGGAATAAAATATTATCTTAGGCTGTTGTTCTCAATGCCAGAAATGTTCTGGGTTTTGATGTTCTAAAAGGTTTTTGTTTTCACATTAATGTTGTACTTGAAAATGTTCTGTTCATCTAACCCTTTAAAAATGAGTTTTAAAACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27199
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037109 Nonsense 365 634 11 16
Genomic Location (Zv9):
Chromosome 8 (position 24722922)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23848740
GRCz11 8 23869979
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAACTGTAACGGCTGCCTGCACTCCAGTAAAACACAGCCTGAGGAGGAC[G/T]AGCAAGGAGACCTGCAGTATGGCCAGTTACTACAAGAGGACCACCATAAC
Long Flanking Sequence:
GGAAAGTTTTGCTTTAAAACATTAACACTATTAAATACCTTGCTCTTCCTTAGGCACCAAAAATGTCAAAAAACAAGAAAAAGAAGCTAAAGAAGAAGCAGAAGCGTCAAGCGGAGCTCCTGGAGAAGTGCATCATGGACTTGGAAGAGATGGAGATTGGGCCTGAGGGCAGAGAGGAAGAAGAGGACGACCCAGAATCCCCCAAATCTCCCTCCTGCGCCCCACTTAGACAGGCGTCACTGCAGGAAATTGCTACTGAGGACATAATAAGTTAGTTTCTATTTGTACCTTGTATAAATTATGGTTATTTAGAAGGTGATTTGTTACTCAAGTGTACAGTTAGTGGCAATGATGTAATATAAATGGAGCCATTATAACTTCGCTATTTTTTTGCATCCCTTGTAATAGTGGACACCAGAGAGAGACTAACATCAGATGCTTCAGTCGAGCTTAACTGTAACGGCTGCCTGCACTCCAGTAAAACACAGCCTGAGGAGGAC[G/T]AGCAAGGAGACCTGCAGTATGGCCAGTTACTACAAGAGGACCACCATAACGCAAACGCAGGCCCAGAGGACACGGCTCAAAGCATGTATGAGTACTGTAATGGGGCAGAATCCCCTGAACTTGATCAGGCCTGTTATAGTAACGGCACCTCAGGCCAAGAGCAGCTGGAGGATGGAGAACTGGCAACCGAAGAGCAACATCAGCAAAAGACTAGAACCAGAGCCAGGGAACAGAACAAAGATAAGATAAAGGACGGTCAGTTCGAATTATATTCGTAATCATTTCCAGAAAACGTATGACATCTCTTTTAGATGTCCCTCCTGGCTTACTGCCAACTGTTTGTTTTAAATGGGTTGTTTTTATTTACTATCCCTTATAGTTTTAGATTCATGTAAACACAGTGAGAATTCTTGATGAGTCCGACTGCAGTAGTAGTTTGTAGTGAGGATGCATGGCTGTTTTTAATTGGCTCTTTTTCTGCTTGTAGACAAGTTGTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9382
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037109 Nonsense 394 634 11 16
Genomic Location (Zv9):
Chromosome 8 (position 24723011)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23848829
GRCz11 8 23870068
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACCACCATAACGCAAACGCAGGCCCAGAGGACACGGCTCAAAGCATGTA[T/G]GAGTACTGTAATGGGGCAGAATCCCCTGAACTTGATCAGGCCTGTTATAG
Long Flanking Sequence:
AAGAAGAAGCAGAAGCGTCAAGCGGAGCTCCTGGAGAAGTGCATCATGGACTTGGAAGAGATGGAGATTGGGCCTGAGGGCAGAGAGGAAGAAGAGGACGACCCAGAATCCCCCAAATCTCCCTCCTGCGCCCCACTTAGACAGGCGTCACTGCAGGAAATTGCTACTGAGGACATAATAAGTTAGTTTCTATTTGTACCTTGTATAAATTATGGTTATTTAGAAGGTGATTTGTTACTCAAGTGTACAGTTAGTGGCAATGATGTAATATAAATGGAGCCATTATAACTTCGCTATTTTTTTGCATCCCTTGTAATAGTGGACACCAGAGAGAGACTAACATCAGATGCTTCAGTCGAGCTTAACTGTAACGGCTGCCTGCACTCCAGTAAAACACAGCCTGAGGAGGACGAGCAAGGAGACCTGCAGTATGGCCAGTTACTACAAGAGGACCACCATAACGCAAACGCAGGCCCAGAGGACACGGCTCAAAGCATGTA[T/G]GAGTACTGTAATGGGGCAGAATCCCCTGAACTTGATCAGGCCTGTTATAGTAACGGCACCTCAGGCCAAGAGCAGCTGGAGGATGGAGAACTGGCAACCGAAGAGCAACATCAGCAAAAGACTAGAACCAGAGCCAGGGAACAGAACAAAGATAAGATAAAGGACGGTCAGTTCGAATTATATTCGTAATCATTTCCAGAAAACGTATGACATCTCTTTTAGATGTCCCTCCTGGCTTACTGCCAACTGTTTGTTTTAAATGGGTTGTTTTTATTTACTATCCCTTATAGTTTTAGATTCATGTAAACACAGTGAGAATTCTTGATGAGTCCGACTGCAGTAGTAGTTTGTAGTGAGGATGCATGGCTGTTTTTAATTGGCTCTTTTTCTGCTTGTAGACAAGTTGTCAGCTGGAAGCCTATTGGTCAACCCACTGGATCCGCTCAATGCTGACAAGATCAAGGTTAAGATTGCAGACCTTGGAAATGCCTGCTGGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21287
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037109 Essential Splice Site 450 634 12 16
Genomic Location (Zv9):
Chromosome 8 (position 24723409)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23849227
GRCz11 8 23870466
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTAGTGAGGATGCATGGCTGTTTTTAATTGGCTCTTTTTCTGCTTGTA[G/T]ACAAGTTGTCAGCTGGAAGCCTATTGGTCAACCCACTGGATCCGCTCAAT
Long Flanking Sequence:
GCCTGAGGAGGACGAGCAAGGAGACCTGCAGTATGGCCAGTTACTACAAGAGGACCACCATAACGCAAACGCAGGCCCAGAGGACACGGCTCAAAGCATGTATGAGTACTGTAATGGGGCAGAATCCCCTGAACTTGATCAGGCCTGTTATAGTAACGGCACCTCAGGCCAAGAGCAGCTGGAGGATGGAGAACTGGCAACCGAAGAGCAACATCAGCAAAAGACTAGAACCAGAGCCAGGGAACAGAACAAAGATAAGATAAAGGACGGTCAGTTCGAATTATATTCGTAATCATTTCCAGAAAACGTATGACATCTCTTTTAGATGTCCCTCCTGGCTTACTGCCAACTGTTTGTTTTAAATGGGTTGTTTTTATTTACTATCCCTTATAGTTTTAGATTCATGTAAACACAGTGAGAATTCTTGATGAGTCCGACTGCAGTAGTAGTTTGTAGTGAGGATGCATGGCTGTTTTTAATTGGCTCTTTTTCTGCTTGTA[G/T]ACAAGTTGTCAGCTGGAAGCCTATTGGTCAACCCACTGGATCCGCTCAATGCTGACAAGATCAAGGTTAAGATTGCAGACCTTGGAAATGCCTGCTGGGTGGTAAGAGTCAGTCGAAATCCAAATTGTTGTAATTTCTTGAAGAAGTGCAGCTATACATAATGTAGTGTATTTTTTCTTAGCTATGATAATATTGATTTAAATTATGGAAAGAACACTATAATTTGGGGTAATTAAATTTTTAAAATTATTTTAAATTAATCAAAATGCCTGTAAAGACACTTTTTTTAATGAAAGGTTCAAGTGACACTAGTATTGCTGAAAATCCAGCTTTGCCCATCACAAGAATACATAGAATTTACATTATATACATTTTACATAATATATATTTCACAATAAATTATTTTTATCGTATGTTTAATCAAATTATTGGTTTTACAAAATGTAATAAAGATGTTACTAGTACCACATTTTTAAATGGAAGTTTATTTGGCTCCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15574
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037109 Nonsense 585 634 16 16
Genomic Location (Zv9):
Chromosome 8 (position 24731519)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23857337
GRCz11 8 23878576
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATGTGTTCTCTATAGGTGACCTGAAGCACATCACCAAACTGAAGCCATG[G/A]GGTYTGCTGGACGTCCTGATGGATAAGTACGAGTGGCCTCAGGAGGAAGC
Long Flanking Sequence:
GATATTTGTTTGTGGCTTGACATTCATTCCAAACACAAGATTAAACAAAACCATAAAGATTTCATTAGTTACCTTAAGTAAACACATCAACTAGCAGTATCTAACAATAAGCAGTATGTTTATTACAGTATTTAGGGATCTATTTATCTTTGTTGGTTTATTTAAAAGTAATTGTTGTTTCAGGTTTATTAAATATTTGCTTTTGAAATCATTGATTAATCAATTTAGTTGTTTAATGATGTCAAATGATACTGTAATATTACTTGTAGCCAAAAACTAGGGATGCTCTGGTCATTCTTTATTTGTCATAGAATGTATTATCAGCTAATACTGATCCAAAATTATTCAGAGCATCTCTTAAATAATAATAATAATAATAAAAATAATATATATATATATATATATAGGCAATAGCATGAACTGAATAGAACCAGTAGCCTGGTCTCTGATAATGTGTTCTCTATAGGTGACCTGAAGCACATCACCAAACTGAAGCCATG[G/A]GGTTTGCTGGACGTCCTGATGGATAAGTACGAGTGGCCTCAGGAGGAAGCCCAAACCTTCAGTGATTTCCTGCTTCCTATGCTGGAGCTCCTGCCTGAGAAAAGAGCCACGGCTTCTGACTGTCTGCGACACCCATGGCTTGCCCTCTAGTGGCTTCTCCACGCCACTGCACACTTCAGGCCACCTAAAGAGACTGCAACAGATCACTTTCAGTTTATAGAGCATATCGGCATACTACTTTTTCTTCCGTTCATCCGAGTCATTCGTTTTGCTTGGGAGGAATAGCAAACCTGTCTTTTTGTTCTCAACTGTTATTATTATTATACATTTTTTTTTCCAGAGTTGAGAGGTTTATTGTGAGGGTCAAATCTGCCGAGATCCTTCCGCCATTCCTCTTATTTTGGTAAAGGATGACTTGTAGACCTAGGAAATTCCTGTTTGTTTTGATTTCCAGAAGTCGTGAAATGTTTTTTGCAGTTCTGAACGGAGACTGCAGCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21288
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037109 Nonsense 626 634 16 16
Genomic Location (Zv9):
Chromosome 8 (position 24731642)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23857460
GRCz11 8 23878699
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCCTATGCTGGAGCTCCTGCCTGAGAAAAGAGCCACGGCTTCTGACTG[T/A]CTGCGACACCCATGGCTTGCCCTCTAGTGGCTTCTCCACGCCACTGCACA
Long Flanking Sequence:
TACAGTATTTAGGGATCTATTTATCTTTGTTGGTTTATTTAAAAGTAATTGTTGTTTCAGGTTTATTAAATATTTGCTTTTGAAATCATTGATTAATCAATTTAGTTGTTTAATGATGTCAAATGATACTGTAATATTACTTGTAGCCAAAAACTAGGGATGCTCTGGTCATTCTTTATTTGTCATAGAATGTATTATCAGCTAATACTGATCCAAAATTATTCAGAGCATCTCTTAAATAATAATAATAATAATAAAAATAATATATATATATATATATATAGGCAATAGCATGAACTGAATAGAACCAGTAGCCTGGTCTCTGATAATGTGTTCTCTATAGGTGACCTGAAGCACATCACCAAACTGAAGCCATGGGGTTTGCTGGACGTCCTGATGGATAAGTACGAGTGGCCTCAGGAGGAAGCCCAAACCTTCAGTGATTTCCTGCTTCCTATGCTGGAGCTCCTGCCTGAGAAAAGAGCCACGGCTTCTGACTG[T/A]CTGCGACACCCATGGCTTGCCCTCTAGTGGCTTCTCCACGCCACTGCACACTTCAGGCCACCTAAAGAGACTGCAACAGATCACTTTCAGTTTATAGAGCATATCGGCATACTACTTTTTCTTCCGTTCATCCGAGTCATTCGTTTTGCTTGGGAGGAATAGCAAACCTGTCTTTTTGTTCTCAACTGTTATTATTATTATACATTTTTTTTTCCAGAGTTGAGAGGTTTATTGTGAGGGTCAAATCTGCCGAGATCCTTCCGCCATTCCTCTTATTTTGGTAAAGGATGACTTGTAGACCTAGGAAATTCCTGTTTGTTTTGATTTCCAGAAGTCGTGAAATGTTTTTTGCAGTTCTGAACGGAGACTGCAGCGTGATGCACATGAGATTTTTTGTTACTAGTTTTCAGAGATGGAAAGCGATGAGGGTTTTTGGAAAGGGAATTGTTGGTTTACCTTTATGACTGTAGAGTATAAATTAAGATTATTTTTGTTCGCCG
Associated Phenotype:
Not determined