Busch Lab

ZMP

LOC794003

Ensembl ID:
ENSDARG00000073976
Human Orthologues:
ZP1, ZP4
Human Descriptions:
zona pellucida glycoprotein 1 (sperm receptor) [Source:HGNC Symbol;Acc:13187]
zona pellucida glycoprotein 4 [Source:HGNC Symbol;Acc:15770]
Mouse Orthologue:
Zp1
Mouse Description:
zona pellucida glycoprotein 1 Gene [Source:MGI Symbol;Acc:MGI:103073]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa39675 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19555 Nonsense Available for shipment Available now
sa6601 Nonsense Mutation detected in F1 DNA Not yet available
sa39674 Nonsense Mutation detected in F1 DNA Not yet available
sa39673 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39675
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114006 Essential Splice Site 140 1036 1 19
Genomic Location (Zv9):
Chromosome 1 (position 45778402)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44621531
GRCz11 1 45313326
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAAACGAGCATCTGTTATCGAGGACGGATTTCAAGGCGATGCTCCAGG[T/C]AAGATTTCCTGTTTTATAATTATGTATGGTCGAGTGGGAATAAAGTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19555
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114006 Nonsense 404 1036 7 19
Genomic Location (Zv9):
Chromosome 1 (position 45772528)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44615657
GRCz11 1 45307965
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCATGTTTCCCCATCATCATCATCATCATCATCACCGTCATCGTCATTA[T/A]CCTGCACCTCCTGTGGATGCTCTTCCCAAATTTTCAATAAAGCCATATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6601
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114006 Nonsense 528 1036 8 19
Genomic Location (Zv9):
Chromosome 1 (position 45772067)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44615196
GRCz11 1 45307504
KASP Assay ID:
554-4813.1 (used for ordering genotyping assays)
KASP Sequence:
TTGYTCTTCTYATAATATTYGTAAAGATGTGGAGACAAAAGAATGGATCT[C/A]GATTTCATCGGTGTCCGCTGCCTGTAACTACAACCTTCGCTCTGTAGGGR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39674
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114006 Nonsense 538 1036 8 19
Genomic Location (Zv9):
Chromosome 1 (position 45772036)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44615165
GRCz11 1 45307473
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGACAAAAGAATGGATCTCGATTTCATCGGTGTCCGCTGCCTGTAACTA[C/A]AACCTTCGCTCTGTAGGGGATAATGTTGTGCTCTCTTCACCACTCCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39673
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114006 Essential Splice Site 857 1036 14 19
Genomic Location (Zv9):
Chromosome 1 (position 45766196)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44609325
GRCz11 KZ115980.1 5428
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTCCCTCAGTCTAAATTACGGCACAATCACCAGAGATTCGCCTGTAAG[G/A]TACATGTAGTAATTCAGTTACACTGGTTCTCAAACAACCGAGCAGCATTC
Associated Phenotype:
Not determined