Busch Lab

ZMP

si:dkey-202b22.5

Ensembl ID:
ENSDARG00000073965
ZFIN ID:
ZDB-GENE-041210-175
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RH03]
Human Orthologue:
C12orf63
Human Description:
chromosome 12 open reading frame 63 [Source:HGNC Symbol;Acc:24777]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa20256 Nonsense Available for shipment Available now
sa2158 Essential Splice Site F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26279
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036401 Nonsense 140 1085 3 28
ENSDART00000110028 None None 279 None 7
ENSDART00000135276 None None 188 None 4
Genomic Location (Zv9):
Chromosome 4 (position 17545057)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18487897
GRCz11 4 18476873
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACTTGGGGTTTATCAGGTGTTTGCAGCATTGTGCAGTCATTTATATTT[C/T]AAACATGGATAAACTGAAAGATAAAGTTATCTGGCTTTAATATTTTCTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26280
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036401 Nonsense 295 1085 7 28
ENSDART00000110028 None None 279 None 7
ENSDART00000135276 None None 188 None 4
Genomic Location (Zv9):
Chromosome 4 (position 17546232)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18489072
GRCz11 4 18478048
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATGTATAATGGTTTGTATATTGTATTTTTCCTCATTACTGCAGATGTA[C/T]AGAGAGCCATGTGTTTGGTGCGTGTACCGCTTGATGTCGAGGAAACACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20256
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036401 Nonsense 391 1085 9 28
ENSDART00000110028 Nonsense 99 279 3 7
ENSDART00000135276 None None 188 None 4
Genomic Location (Zv9):
Chromosome 4 (position 17548590)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18491430
GRCz11 4 18480406
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCACACTCCTGCTGGACTAAAGCTCTAGACTGTGCTCTTCAAAGCTA[T/A]GGAGTTCTGGAGTCTTGGGATGGAGACACCTGGGGCAGCAGTTCGTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2158
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036401 Essential Splice Site 431 1085 9 28
ENSDART00000110028 Essential Splice Site 139 279 3 7
ENSDART00000135276 None None 188 None 4
Genomic Location (Zv9):
Chromosome 4 (position 17548711)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18491551
GRCz11 4 18480527
KASP Assay ID:
554-2836.1 (used for ordering genotyping assays)
KASP Sequence:
GGATATGGGGCTGTCTCCAGGGAGCTGTGCTTTCAGCCAAGATCGCACAG[T/C]GAGTGAAAACCCAAAAGGTGTTTTTGAGACAGCTTTCCATTACAGCTGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8164
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036401 Splice Site, Nonsense 603 1085 14 28
ENSDART00000110028 None None 279 None 7
ENSDART00000135276 None None 188 None 4
Genomic Location (Zv9):
Chromosome 4 (position 17553741)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18496581
GRCz11 4 18485557
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAAGAAAATATTTAATGAAGGGAAACCCCTGATGGATCYRTCCAACCTT[C/T]AAGTAAGTTTACWTGTTTTCACAGCTACATTYCAAATCATGTAGAGGATA
Associated Phenotype:
Not determined