Busch Lab

ZMP

si:ch211-258f14.2

Ensembl ID:
ENSDARG00000073963
ZFIN ID:
ZDB-GENE-070705-151
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A5I8]
Human Orthologue:
C12orf56
Human Description:
chromosome 12 open reading frame 56 [Source:HGNC Symbol;Acc:26967]
Mouse Orthologue:
D930020B18Rik
Mouse Description:
RIKEN cDNA D930020B18 gene Gene [Source:MGI Symbol;Acc:MGI:2442001]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa418 Nonsense Available for shipment Available now
sa33368 Nonsense Mutation detected in F1 DNA Not yet available
sa40210 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3474
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109609 Nonsense 58 591 1 13
ENSDART00000133973 Nonsense 58 577 1 12
Genomic Location (Zv9):
Chromosome 4 (position 4653580)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4771761
GRCz11 4 4780331
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCGGTCAAGAAGGTGTTCATGCATGTGATTTTGAGCGACGAGTGCGTGTA[T/A]TTGAGCGAGTATCACCCGCGCGCGCTGCGAGAGGCGCTCAGTTTCAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa418
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109609 Nonsense 451 591 10 13
ENSDART00000133973 Nonsense 437 577 9 12
Genomic Location (Zv9):
Chromosome 4 (position 4635811)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4753992
GRCz11 4 4762562
KASP Assay ID:
554-0279.1 (used for ordering genotyping assays)
KASP Sequence:
ATAATGAAAAGTCTTTGTGTTTGGCAGCTGCAGAGTCTGCAGGCGGACTA[T/A]CTGGATGCAGCATCTGCTCTGCTGTTTGAGGTGGTTGTGCTATGTCAGGA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa33368
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109609 Nonsense 500 591 12 13
ENSDART00000133973 Nonsense 486 577 11 12
Genomic Location (Zv9):
Chromosome 4 (position 4633967)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4752148
GRCz11 4 4760718
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACCTTTAGCTAATGGGTTTATCTCCATCTCAGCTCCCATTTGTTGGATA[T/A]CAGGCCCAACAGACGGTTCTGGTTCTCTCAGGCCCGCAGTTTCCCATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40210
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109609 Nonsense 541 591 12 13
ENSDART00000133973 Nonsense 527 577 11 12
Genomic Location (Zv9):
Chromosome 4 (position 4633845)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4752026
GRCz11 4 4760596
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTACCAGCGATGCTGTGTTTTATTAGCCTGTCTGCAGCACAGCCCCTGTT[T/A]GAGCAAATACATCAGGACAGGATTCAAGGAGGAGTTCAGGTCCTTCATGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3481
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109609 Nonsense 574 591 13 13
ENSDART00000133973 Nonsense 560 577 12 12
Genomic Location (Zv9):
Chromosome 4 (position 4631769)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4749950
GRCz11 4 4758520
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAAGACTGCAGATCTGGAGGACAAACTTCCCGATCACTATCCCATCAGT[C/T]AACCTGCCCAGCGGCTTCTTTCTCAACTCCTCAGTGTGGTCCTAGAGAGA
Associated Phenotype:
Not determined