Busch Lab

ZMP

SLC4A7

Ensembl ID:
ENSDARG00000073952
Description:
solute carrier family 4, sodium bicarbonate cotransporter, member 7 [Source:HGNC Symbol;Acc:11033]
Human Orthologue:
SLC4A7
Human Description:
solute carrier family 4, sodium bicarbonate cotransporter, member 7 [Source:HGNC Symbol;Acc:11033]
Mouse Orthologue:
Slc4a7
Mouse Description:
solute carrier family 4, sodium bicarbonate cotransporter, member 7 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa1291 Essential Splice Site F2 line generated Not yet available
sa22928 Nonsense Available for shipment Available now
sa22927 Essential Splice Site Available for shipment Available now
sa36235 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa1291
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112879 Essential Splice Site 90 1092 3 24
Genomic Location (Zv9):
Chromosome 16 (position 45572891)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42831081
GRCz11 16 42734839
KASP Assay ID:
554-1206.1 (used for ordering genotyping assays)
KASP Sequence:
GAAAGACAGATGCTCTGAGCGAGAGGACGGCAGAGATTCACCAACGTACG[G/A]TAAGAAAAGCAGGTCATAATGGGGCTAATCTATCTGTTTTATTTGCTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22928
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112879 Nonsense 275 1092 7 24
Genomic Location (Zv9):
Chromosome 16 (position 45563697)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42821887
GRCz11 16 42725645
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCCCAGTCGGCCCCGGGCATCCTGGAGAACAGTAAGTCCAGTGAAAGC[C/T]GAATAAATGGCACCGGTGGCAGCAGGGAAAATAGCACAGTGGACTTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22927
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112879 Essential Splice Site 345 1092 8 24
Genomic Location (Zv9):
Chromosome 16 (position 45558586)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42816776
GRCz11 16 42720534
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGCCTGCTGTTCTTCTCACCGGACTGACCGAAGTGCCCGTTCCGACAAG[G/A]TAGGACTACTGAAAACATGACTTGTTTACATGAATGGAGCCCCTTATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36235
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112879 Nonsense 497 1092 12 24
Genomic Location (Zv9):
Chromosome 16 (position 45553718)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42811908
GRCz11 16 42715666
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTTTAGCCTGCAGTGTTTGGCCTCCATCCTTTTCCTCTATTGTGCCTG[T/A]ATGTCCCCCGTCATCACCTTCGGAGGCCTTCTGGGGGAAGCCACCAAAAA
Associated Phenotype:
Not determined