Busch Lab

ZMP

mrc1a

Ensembl ID:
ENSDARG00000073928
ZFIN ID:
ZDB-GENE-090915-4
Description:
Mannose receptor C1-like protein [Source:UniProtKB/TrEMBL;Acc:C1J0C7]
Human Orthologues:
MRC1, MRC1L1
Human Descriptions:
mannose receptor, C type 1 [Source:HGNC Symbol;Acc:7228]
mannose receptor, C type 1-like 1 [Source:HGNC Symbol;Acc:23403]
Mouse Orthologue:
Mrc1
Mouse Description:
mannose receptor, C type 1 Gene [Source:MGI Symbol;Acc:MGI:97142]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa27081 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21118 Nonsense Available for shipment Available now
sa38650 Nonsense Mutation detected in F1 DNA Not yet available
sa31612 Essential Splice Site Available for shipment Available now
sa21117 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27081
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112544 Essential Splice Site 216 1440 3 30
Genomic Location (Zv9):
Chromosome 7 (position 65454743)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58636483
GRCz11 7 58938913
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACACAGACTATGACACAGACAAAAAGTGGGGCTTTTGTCCAACTAAAA[G/A]TGAGTAATTCTGCCCTATGAAAACATTTTAGATACTTCTCACAAAATAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3626
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112544 Essential Splice Site 353 1440 6 30
Genomic Location (Zv9):
Chromosome 7 (position 65451753)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58633493
GRCz11 7 58935923
KASP Assay ID:
2259-9701.1 (used for ordering genotyping assays)
KASP Sequence:
AGGCTACATCTGTCGCAAAGGCAATTCAACAGATAACACACCTCCACCAG[G/A]TAAAATTTTATCTGTGCAGTAAATGCATTGAATTATCTGGGTAAATATGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2407
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112544 Essential Splice Site 354 1440 7 30
Genomic Location (Zv9):
Chromosome 7 (position 65448818)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58630558
GRCz11 7 58932988
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATCTATTAAAACATGACATGGCAAGGTTTTACAAAGATATTTTTCTTGC[A/C]GGTAAAGATCAGCCCAACTTCTGTCCTGCTGCATGGGTGCCATATGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21118
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112544 Nonsense 374 1440 7 30
Genomic Location (Zv9):
Chromosome 7 (position 65448755)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58630495
GRCz11 7 58932925
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCAACTTCTGTCCTGCTGCATGGGTGCCATATGCTGGTAATTGCTATTA[T/A]CTGCAGCGCACCAAGAAAATGTGGAATGATGCATTAGCAGCATGTCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38650
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112544 Nonsense 507 1440 10 30
Genomic Location (Zv9):
Chromosome 7 (position 65445916)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58627656
GRCz11 7 58930086
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGAATTGTCAATGTGACTAAATTATATGTCTTTTGTTCCCATAGGGCT[G/A]GGTTAGATATGGCTCATACTGCTATATGAGTGCCATTGAAAGCAAGACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31612
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112544 Essential Splice Site 544 1440 10 30
Genomic Location (Zv9):
Chromosome 7 (position 65445804)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58627544
GRCz11 7 58929974
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACAGATTTGTGAGCAGACAGGAGCCAATTTGGTTGATGTTGCCAGCAG[G/A]TAATGCATATAATATATGTTGATGGTTATACTGTATACAATACACTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21117
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112544 Nonsense 820 1440 17 30
Genomic Location (Zv9):
Chromosome 7 (position 65431421)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58613161
GRCz11 7 58915591
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTTCATCAACGAAGAGTCCCTACCTATGGAAGATGCTCGCTCGTTCTG[C/A]AAAAAGAATAATGGGGATCTTGTTGTCATTACTGGACAAACAGAGAGGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8294
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112544 Essential Splice Site 1296 1440 27 30
ENSDART00000112544 Essential Splice Site 1296 1440 27 30
Genomic Location (Zv9):
Chromosome 7 (position 65411428)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58593168
GRCz11 7 58895598
KASP Assay ID:
554-6161.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGGACGGAGTYAGATCATTCTGGATTGGCATGCATCGCAGTTATATGG[G/A]TTAGAAACACACNNAAACCAAACAACCACAAGAATCAAAATKATATCAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18898
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112544 Essential Splice Site 1296 1440 27 30
ENSDART00000112544 Essential Splice Site 1296 1440 27 30
Genomic Location (Zv9):
Chromosome 7 (position 65411428)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58593168
GRCz11 7 58895598
KASP Assay ID:
554-6161.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGGACGGAGTCAGATCATTCTGGATTGGCATGCATCGCAGTTATATGG[G/A]TTAGAAACACACTTAAACCAAACAACCACAAGAATCAAAATTATATCAGA
Associated Phenotype:
Not determined