Busch Lab

ZMP

ftr41

Ensembl ID:
ENSDARG00000073880
ZFIN ID:
ZDB-GENE-090507-6
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa38410 Nonsense Mutation detected in F1 DNA Not yet available
sa33304 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38410
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055690 Nonsense 138 550 1 6
Genomic Location (Zv9):
Chromosome 3 (position 50153338)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 44847758
GRCz11 3 48993169
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGTCAAGTCCTGTCTGCAGTGTCAAGAATCTTACTGTCAAACTCATTTT[G/T]AGCGTCATGAGGAGTTTCACTCTCGTAAACCACACAAAGTGATTGATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33304
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055690 Essential Splice Site 206 550 1 6
Genomic Location (Zv9):
Chromosome 3 (position 50153130)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 44847550
GRCz11 3 48992961
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAAAACCACGCAACTGTATCAACAGCAGAACAGATGACAGAGAAACAGG[T/A]ACGAGCTTGAAGAGATTGTTCACCTAAAAACAACAATCATTCATCATTCA
Associated Phenotype:
Not determined