Busch Lab

ZMP

KIF13B (2 of 2)

Ensembl ID:
ENSDARG00000073859
Description:
kinesin family member 13B [Source:HGNC Symbol;Acc:14405]
Human Orthologue:
KIF13B
Human Description:
kinesin family member 13B [Source:HGNC Symbol;Acc:14405]
Mouse Orthologue:
Kif13b
Mouse Description:
kinesin family member 13B Gene [Source:MGI Symbol;Acc:MGI:1098265]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa37167 Nonsense Mutation detected in F1 DNA Not yet available
sa9347 Nonsense Mutation detected in F1 DNA Not yet available
sa23817 Essential Splice Site Available for shipment Available now
sa3078 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37167
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058858 Nonsense 443 1097 13 25
Genomic Location (Zv9):
Chromosome 20 (position 50178027)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 50063060
GRCz11 20 49866274
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTGTTCAGGAGCGTCAGAAGCAGCTGGAGAGTTTGGGCATTTCTCTA[C/T]AGTCGTCTGGAATCAGAGTCATCGATGAGAAATGTTTCCTGGTGAACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9347
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058858 Nonsense 623 1097 17 25
Genomic Location (Zv9):
Chromosome 20 (position 50170983)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 50056016
GRCz11 20 49859230
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGATGCAGTCAGTGCTTCACTCTCTGGAGCGCAGACATGAGGAGGAGAAG[C/T]GATCTGCTCTGGAGCGTCAGCGGCTCATGTACGAGCAGGAGCTCCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23817
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058858 Essential Splice Site 933 1097 22 25
Genomic Location (Zv9):
Chromosome 20 (position 50157405)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 50042438
GRCz11 20 49845652
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCAGCAGTAGAGAACCACAGAGTCTGGTGGTGTTCGACAACTGCAAGG[T/C]CTCAGTTCATCACAAAAAACACTACATTTGTGCCATTTATTTCTCTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3078
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058858 Nonsense 984 1097 23 25
Genomic Location (Zv9):
Chromosome 20 (position 50154867)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 50039900
GRCz11 20 49843114
KASP Assay ID:
554-3036.1 (used for ordering genotyping assays)
KASP Sequence:
ATCTGGCTCTCTGGGACCTGGGGGTGATTCAGGCCAAGACTCGCTCTCTC[A/T]GAGAAAGGTATATTTGCATTCTAGATTTTTATTGAATTTATATATATATA
Associated Phenotype:
Not determined