Busch Lab

ZMP

MYO9A (2 of 2)

Ensembl ID:
ENSDARG00000073843
Description:
myosin IXA [Source:HGNC Symbol;Acc:7608]
Human Orthologue:
MYO9A
Human Description:
myosin IXA [Source:HGNC Symbol;Acc:7608]
Mouse Orthologue:
Myo9a
Mouse Description:
myosin IXa Gene [Source:MGI Symbol;Acc:MGI:107735]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa39467 Nonsense Mutation detected in F1 DNA Not yet available
sa44210 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16393 Nonsense Available for shipment Available now
sa37972 Nonsense Mutation detected in F1 DNA Not yet available
sa24581 Nonsense Available for shipment Available now
sa30171 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39467
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028997 Nonsense 59 1740 2 33
Genomic Location (Zv9):
Chromosome 25 (position 545467)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 504381
GRCz11 25 527278
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAATATTAAAAGTTGAAGAGGATTTAAGTCTGATGTCTTATGTGATCAG[G/T]AGGAGTATCGATCTGAGGGCATCAACTGGCACATGATCGATTATATTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44210
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028997 Essential Splice Site 325 1740 8 33
Genomic Location (Zv9):
Chromosome 25 (position 536510)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 495524
GRCz11 25 518421
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTCTGAAGGAGAAACAAGAACTACAAGCCCAAACCCAGCCTCCCTAAG[G/A]TAAACCTCACGACTTGAATGTGTGAAATACTCAGTGTTGGTTGTTTCTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4301
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028997 Nonsense 406 1740 11 33
Genomic Location (Zv9):
Chromosome 25 (position 534355)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 493369
GRCz11 25 516266
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TASTTCTCTCRCAGCTTCCTCTGCGCTTCAATGATGCGCTGGTGCTGCGA[C/T]AGCTCAGGTACACCGGCATGYTGGAGACCGTCAGGATACGACAGTCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16393
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028997 Nonsense 465 1740 12 33
Genomic Location (Zv9):
Chromosome 25 (position 532925)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 491939
GRCz11 25 514836
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGGGCATCCGAGAGTTCCTGCGCAGTGCAGACTTGGAGCCCAGYGGCTA[T/G]CAAGTGGGCCGCAGTATGGTAAGAGACACACTGACCAMCCCTATAATGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30172
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028997 Nonsense 613 1740 14 33
Genomic Location (Zv9):
Chromosome 25 (position 528507)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 487521
GRCz11 25 510418
KASP Assay ID:
2261-9209.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACACACCGGCGGAGCTTTCTGCAGCAGCGCCGTGCCGCCGTCACACTA[C/T]AAGCCGCCTGCAGGGGGCAGCAGAGTCGACAACGGTAACACTCTTCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37972
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028997 Nonsense 705 1740 15 33
Genomic Location (Zv9):
Chromosome 25 (position 527889)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 486903
GRCz11 25 509800
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCAACGAGAACTCGAACAAGCCACGTTCAGTTTAGAGCTGCTCAAAGTC[C/T]GATCCGGATCAAACACAGAAGACGCTCAGATCCCTCCGTCCAAACATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24581
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028997 Nonsense 1302 1740 25 33
Genomic Location (Zv9):
Chromosome 25 (position 516842)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 475856
GRCz11 25 498753
KASP Assay ID:
2261-9208.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTGGTGGAGAAGCTGATCAACTACATCGAGATGCACGGCCTCTACACC[G/T]AGGGCATCTACAGGAAGTCTGGATCCACCAATAAGATCAAAGAGCTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30171
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028997 Nonsense 1453 1740 29 33
Genomic Location (Zv9):
Chromosome 25 (position 510323)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 469337
GRCz11 25 492234
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAACTAAATGCCGTTATCTTGCCCTCAGGTGTGTGGAGCTTATCATCTG[T/A]GAGCAGATGAGGAAATATAAAGCCCGACTGAAGGACATCAACACACTGGA
Associated Phenotype:
Not determined