Busch Lab

ZMP

rasgrf1

Ensembl ID:
ENSDARG00000073824
Human Orthologue:
RASGRF1
Human Description:
Ras protein-specific guanine nucleotide-releasing factor 1 [Source:HGNC Symbol;Acc:9875]
Mouse Orthologue:
Rasgrf1
Mouse Description:
RAS protein-specific guanine nucleotide-releasing factor 1 Gene [Source:MGI Symbol;Acc:MGI:99694]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa45639 Nonsense Mutation detected in F1 DNA Not yet available
sa45640 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45639
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109257 Nonsense 61 1256 1 27
Genomic Location (Zv9):
Chromosome 18 (position 26124913)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26353906
GRCz11 18 26338424
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCTCTGTTGCAAAATATGCTTTTTTATTTTGAGAGCGAGTCCAGCTCG[C/T]GACCCTCGGGATTATACCTGTTGGAGGGATGTGTGTGTGACAGGTCGCCC
Long Flanking Sequence:
AACCATCACTCGCATACACTGTAGCCTAATTCTCTCCGCTCACTGCGTCACAGAAGAGCTTACGGGAGGCATTTTTGTACCTTTTTCCACCGCTTGAACGCGTTCGACAACATTACGATGGTAGACTTTGGCATTCTTCGTTTTTCTCTGCGCTTCTTTCCTACTTCATGCCAAGGCGGTGATTGCAGTGGATGGGCAGAACGTGCCAGGCTTCGTTTCTAATCCAAAAAGTGCCCGTCTACTCGGGGATCTCGCGCTAAGAAGATGTAAGGACCAAAACAAGCCTTCACCCTGCAAAACTATCATCTTTCTTCACAAAAATGCAGAAGGGAATTCGGCTGAATGATGGTCATGTCACCTACCTGGGTCTTTTGGCGAAGAAGGATGGCACGAGGCGAGGCTGCTTAAGCAAAAAGAGCTCCGACAACACAAAATGGCACACCAAGTGGTTTGCTCTGTTGCAAAATATGCTTTTTTATTTTGAGAGCGAGTCCAGCTCG[C/T]GACCCTCGGGATTATACCTGTTGGAGGGATGTGTGTGTGACAGGTCGCCCTCACCCAAACCTTCACTGTCAGCCAAGGAGTGCTTAGAAAAACAGGTATGAAACAAACGGAACGACAACTTCTGTGCTTACTTCTTCTAGACCTTTAAAATAGAGTTACTTTTCTGGGAAAGGGGAGTAAACTGAGATGCCTGTTTCCATCTAGCAGGGACTGGGGGTTTGTTTTATGCGTAAAGATGATGAGCATGCGCTCGACACAGCCGACAATTTCACCACCAGGCAGCTTCTGCTGCTCAGAAATTTTTGCTCTTTGTGTTTTTTTAGTTGTTTAACTAAGGGTTATCTGTCATCTCTACATTTGTATTTGGAAGTGATCATCTTTTAAGTGAGATGACATTACAGTGTTTAAAGCGAATGCGTTACATAATACACGTTTGTTTATTGATCGGTACTCTGTGGTTACATAAATTATGAATGCGTTACAAATGTTTGTGTTAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45640
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109257 Essential Splice Site 1008 1256 20 27
Genomic Location (Zv9):
Chromosome 18 (position 26198546)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26427539
GRCz11 18 26412057
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGGATCCTGGTGATAATCAGATCTGTCTGGAGGAGGTTCTGCAGATGG[T/A]GAGTGTGGTGCTTCTTGATCATCCTCCAGCATATTAAACATTTTTCAGTG
Long Flanking Sequence:
CTGTCTTCCAGGTAGATCTGTAACTTTTTTTTAGTTTATTGGTTCATTATTGTTATGTAAGGCTTACCAAATATCTTCTCCAAACCAGAACTGTACAATATTCTTTAGTTTTACTCATTGTGGTGGATAATGCTTAGAATTTGGCACTTGCGTTTCCTCAAATGCTGGACTCTTATACAGTTTCCAGTTGTACCAATAATTGTGGCCAGTGTACACTGAAGAAAATATATTTCATAATGATACTTCTTTATTATTCCAGCTGTTTCAATTTTTTTTTCAGAATTTTCTCAATGGAACATCAAAAAAAAAAAAACAATGCATTTTTTTTCACAGCTTTTTTGCTCATGCTTGCTAAGTGTGCCAATAATGTTTACCATTACTGAAATTCAGTCAGTGGCTTGGTTTGTGAAAACATTCTCTCTTTTTTTCTTTTGATAGAACACTAACGCAAGAGGATCCTGGTGATAATCAGATCTGTCTGGAGGAGGTTCTGCAGATGG[T/A]GAGTGTGGTGCTTCTTGATCATCCTCCAGCATATTAAACATTTTTCAGTGCCAAAACAATCAGAACTTCATTGTTTCTTCGGAATTTCTTAATATAATTTTATTTTATTTTTTTACTGTACTCTTCAGAGTATGTAAGGTCATCATTAAATGACTCACCTTGACTGCCTGTATTTGAACAATTTTAATATTTCAAAAATTATTTTTCCAGTGATTCTTTTGCAATCATTATTAGTTTTCAGTTGGTGCTGAAGAAATGTAATATGTTTGTTGGTACTGTAATCTTTGTAACGTAAGGTTAGCTATTCAGTTAAAACTTTCAGAAATAAATCTAATTGAATAAATAAATTTGTTCATCCTAAACATCTTGTGCCAAATTATTGTATTGGTTTAAGTTTACGATGCTTTTAACAATTGTGAAAGCTTATAAACTGTGCTGAATCTTTTAAATCCTTTTGTTAATTTATTTTTTATTCATTTAACTAAATGTTTTATTATGTA
Associated Phenotype:
Not determined