Busch Lab

ZMP

thbs2b

Ensembl ID:
ENSDARG00000073810
ZFIN ID:
ZDB-GENE-100623-1
Human Orthologue:
THBS2
Human Description:
thrombospondin 2 [Source:HGNC Symbol;Acc:11786]
Mouse Orthologue:
Thbs2
Mouse Description:
thrombospondin 2 Gene [Source:MGI Symbol;Acc:MGI:98738]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa35323 Nonsense Mutation detected in F1 DNA Not yet available
sa45466 Splice Site Mutation detected in F1 DNA Not yet available
sa6262 Nonsense Mutation detected in F1 DNA Not yet available
sa35324 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35323
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111772 Nonsense 185 1181 2 20
Genomic Location (Zv9):
Chromosome 12 (position 32319495)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30540472
GRCz11 12 30655374
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACATTGGTTGTGGACTCATTGATAGCTTCATTCTTGATGAACCTTTCTA[T/A]GAACACCTTAGTGCAACTGGCGCCAGTATGTTCGTGGCCAAAGGGTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45466
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111772 Splice Site 308 1181 5 20
Genomic Location (Zv9):
Chromosome 12 (position 32326608)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30547585
GRCz11 12 30662487
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGAAGATAGACAGCTGTTTAATTCATTTCAAAACAATTTTTTTTAGAC[A/T]GAAGAAAACACGGCAATGAAGGAGGCGCTAAACAAGATGCAAAGTCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6262
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111772 Nonsense 685 1181 11 20
Genomic Location (Zv9):
Chromosome 12 (position 32334346)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30555323
GRCz11 12 30670225
KASP Assay ID:
554-5440.1 (used for ordering genotyping assays)
KASP Sequence:
CACAAGTTTGCTGAATGCATCTTCCTCAGTCACTTCACTGACCCCATGTA[C/A]AAGTGTGAGTGCCGGATTGGTTATGCTGGAGACGGCATCATCTGTGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35324
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111772 Nonsense 885 1181 15 20
Genomic Location (Zv9):
Chromosome 12 (position 32339503)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30560480
GRCz11 12 30675382
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAATCAGGACATAGATGAAGATGGACATCAAAATAACATGGATAACTG[C/A]CCATACATACCCAACGCTAACCAAGCTGACCACGACGGAGATGGGAAAGG
Associated Phenotype:
Not determined