Busch Lab

ZMP

HOMER1 (1 of 3)

Ensembl ID:
ENSDARG00000073803
Description:
homer homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:17512]
Human Orthologue:
HOMER1
Human Description:
homer homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:17512]
Mouse Orthologue:
Homer1
Mouse Description:
homer homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1347345]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa32321 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32321
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112566 Nonsense 44 132 1 3
Genomic Location (Zv9):
Chromosome 21 (position 174591)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCACCAGAGCTCATGTCTTCCAGATCGACCCGAACACAAAGAAGAACTG[G/A]GTTCCCACCAGCAAGCACGCCGTCACTGTGTCCTACTTCTACGACAGCAC
Associated Phenotype:
Not determined