Busch Lab

ZMP

MAGI2 (1 of 3)

Ensembl ID:
ENSDARG00000073769
Description:
membrane associated guanylate kinase, WW and PDZ domain containing 2 [Source:HGNC Symbol;Acc:18957]
Human Orthologue:
MAGI2
Human Description:
membrane associated guanylate kinase, WW and PDZ domain containing 2 [Source:HGNC Symbol;Acc:18957]
Mouse Orthologue:
Magi2
Mouse Description:
membrane associated guanylate kinase, WW and PDZ domain containing 2 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa44295 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5103
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110879 Essential Splice Site 189 543 4 9
Genomic Location (Zv9):
Chromosome 25 (position 21494370)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 20749925
GRCz11 25 20847579
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCGATTAGCGAAGAAAGCTAAACCTCCAGAGGAGTGTGAGGAAGATGG[T/A]GAGTGTGTTACTGTAACACAAGCGYGYGCGTGTGTGCTTTAYACTGCACT
Long Flanking Sequence:
GAATTTTCCTTTCGGTGCATTCTTATGTCATAAAAAAACATTCACTCTGCAAAACTACATGCTACCACTTTGATTAGGAATGAACTAACACTGGATTTTGCTGAGCCTCATATGAACAAATCGCCATAAAACCGAATCTGCCAGAGCAACAGAAGGAAAAACAATCTCAAGACTCAGAGAATGATGTTTCCTTCCCTCGCATCAGTCCTTAATGAGAAACAAGGGACTTATTAAGAATATCGATTGTCATTGCGGTGACTGGAAAAACCCAACTGTGACTGAGGCCTTCTGGGATACATAATTGAGAATGCTTTACATTTGAAAGAGAGTCTTAGACCAACATTTGGCGCAAAGAGACGCTTCAGTTTCAGATAATGGTAGCTAAACTACAACACAATGTTTTTCTCTGTTCTTTTCAGTCACAATACCAAAACGACGTCATGGCTGGACCCTCGATTAGCGAAGAAAGCTAAACCTCCAGAGGAGTGTGAGGAAGATGG[T/A]GAGTGTGTTACTGTAACACAAGCGCGTGCGTGTGTGCTTTACACTGCACTCATGACCTCTGCTTGTATTTTTTCCCTCTGGAGATGTACGCATGAGAGATTGTTTTATGAATTCTGAAGGGGAGATCGTGTTTTGTAAGATGTCAGAACATATTCTGGTTTCGTAAAACATACAGAAGGACAAGTGCTGCTAGCTTATGATTACACATTGGGTTTCCAATGACAGAATGGATGAGATAAAAATGTCTCAGCTAGCACTGATGAATCGGTTTATTTATTTATCTGTTCATTTATTTGTTCAAGTTATTTGTTTGTTCAGTCATATAACCAGCCATCAGTCAGTCTAAACATACATCCTTTCTCCATGTTTTGGTGTTGATTTGTTTATTCATTCATTCACTTTAAATTAATACTTGTTGTTTTGCTTGATCAGTTGTTTGTCTGATCAGTCATATAGTGATGCATTCATCCGTCTGTCCATTAATTAGGGATTCATTCATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1574
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110879 Essential Splice Site 189 543 5 9
Genomic Location (Zv9):
Chromosome 25 (position 21478784)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 20734339
GRCz11 25 20831993
KASP Assay ID:
554-1517.1 (used for ordering genotyping assays)
KASP Sequence:
AAGATTTGCAACAAGGTGCCGACCATCTTATTTTTTATTTTCTTTTTACA[G/T]AACTTCCATATGGCTGGGAGAAAATCGACGACCCTATTTATGGCAGTTAC
Long Flanking Sequence:
GCTCCACATTTTGTTTGCTTTTTATTTCATTTTCAGATGCAAAACAAATTTACTGTTTACTCACCTTCAAGTGGTTACAGGTTTTCAGCATTCTTCAAACTATCTTCGTTTGTGTTCAACTTTAAAAGAAACTCCCAAGATTTTTAACTTTAGAAATTAGTAAAGGATGAGTAAATTTTTATTTTCTTTAAGTGTGTGTGACATTTATTTTAAAAATATTTAGGTCATTTTGAACCAAACTGTGGTAATATTAAAAATCGTGATAAAAAATTTCCATACCCTTACAATTTATATAATTTGGTTTCATTTGATTTAAACTTATTTATGCAAGGAAACTAAAAATTCAACCCAGACCACATTGAATTTCACTAAGTTATACATAAGGGAATATAGTATATAAGTATACAGTTTATTTAATCCGCTCAATTTATTTATGCATCAGGGATCAGCAAGATTTGCAACAAGGTGCCGACCATCTTATTTTTTATTTTCTTTTTACA[G/T]AACTTCCATATGGCTGGGAGAAAATCGACGACCCTATTTATGGCAGTTACTATGTTGAGTAAGTTGTTCAAATCTCTTCTTCCAAGCCCCAAATACTTAGAAAATCTGACCCCAAATCGCCCGCTTCATGCTCTTCAGTAAAGCGTGTGCGGGGCGCAGATTTTAATATCTGCACGCTCTGCCCCGCAGCCACATTAACAGAAGGACACAGTTTGAGAACCCCGTCCTAGAGGCCAAACGAAGGATCCAACAGCAGCAGCAAATGCAAAGTCAAGGTCTATCGGCGCTGCCATTGCCCACCATATATAGAGGTACTGCTTTTCTCTGTGGCCCATTTATGCCATCTTCACCTGCTTGGTTTGCTTGGTGTTAGGTTTACTTTATTTTACCCTAGTGACCAAAGCACCAAAAGGCCATCCAGTGGAGATGGTTGTGAAGTGTGTTGTTCTTTATCGTCTGACTGTTTGTTTGTGTTTGTCTCGACAGAAAAGCCCCCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44295
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110879 Essential Splice Site 479 543 8 9
Genomic Location (Zv9):
Chromosome 25 (position 21462150)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 20717705
GRCz11 25 20815359
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCGGCTTTACCATAGCGGACAGTCCTACGGGGCAGAGAGTTAAACAGG[T/C]ACGCTGAAATCCATAAGCAAACATTGTAATGTAGGGGTCTTCAGTTCAAA
Long Flanking Sequence:
CGTCTACATCAATGACATCTGTGTTCTGGGCACCACCCATGCTGATGTGGTGAAGCTTTTCCAGTCGGTCCCCATTGGTCAGAGCGTCACCTTGGTATTGTGTCGAGGTTACCCGCTCCCATATGACCCAGAAGATCCTTCGGCAAGCTCCTCCATGCCCCCTTTGGGCCTGGTGGATCACCCGTTGCTGCTTAATGGAAGGAACAACTATGAAAATTATATGGAGTACATGTCTTTGACTGGCCGCTTGGTACCTGAGCATGGTGAGGGCCTCACCCCGCTTCCCCACCCAGGAGACACCCACCTGGATGGCTCACAACCTCCGTCCTTAACCACCCCAGGACCCCCACCTGACGACAGTGTCTCAATGGCATCATCCTCAGGAGCAACAGCCGGGGCTACGGTGGCCCCGGAGCTTCTGAGTCTCACTATAACCAAAGGTGCAGAGGGTTTCGGCTTTACCATAGCGGACAGTCCTACGGGGCAGAGAGTTAAACAGG[T/C]ACGCTGAAATCCATAAGCAAACATTGTAATGTAGGGGTCTTCAGTTCAAACAAAATTTTGTCTATATATAGATCAGTGGAAGAAATAGAGGAAATAAATCAACTGGCATAAATGGCCAGTGTGTTTGTTTTTATGCAATTATGATAGATGAAGTGATTCTAATTAAATAAACTAGAGCCAGTTTATTCTTTTTCCAAACCATGTTTGTTTGTTTTTTTTTGGTCTTCTGTTGAACACAAAAGATATCTTAAAGAATGTTGATGTCAAGTAGCAATTCAGCTCCCTAGCCAGAAGGGTTCAGGAGGTTTTAAAGACCCACCCCCCACTGACAAAGTTCTAGAATTTGTCCCATACATGAGATTATTTGTGTTATTTGGACTGTTATGCTATCATAACTTATCAAAACTTCTGACCAAATACCAAATTCTGACTGAGGAAAGTTGAATGTGCTGGCCAGTTTTTTTATTTGCCTAAAGCTTGATTTATACTTTTGCCTGGCT
Associated Phenotype:
Not determined