Busch Lab

ZMP

si:dkey-266j7.2

Ensembl ID:
ENSDARG00000073752
ZFIN ID:
ZDB-GENE-060503-162
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3QK21]
Human Orthologue:
CACNA2D1
Human Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 1 [Source:HGNC Symbol;Acc:1399]
Mouse Orthologue:
Cacna2d1
Mouse Description:
calcium channel, voltage-dependent, alpha2/delta subunit 1 Gene [Source:MGI Symbol;Acc:MGI:88295]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa36580 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39191 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36580
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080995 Essential Splice Site 41 548 1 18
ENSDART00000143965 None None 76 None 3
Genomic Location (Zv9):
Chromosome 18 (position 9186161)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9763138
GRCz11 18 9732328
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGCATCTGTTCATATCTCGTGCCCATCGCAGTTTCCCAGTCCGCTCATG[T/C]AAGTTCTTTGATGTTGTTTTCGCGTCAACTGGTGATTAAATACAGCTTTT
Long Flanking Sequence:
GCAGAAGGAGGAGAGAGGGGGACTGGAGAGGGTTGCATTGTATGAAGATCCGATGAAAGACAGCAGGCTATCGCAATAAGAGGGCAAGAGAGAGAGGGGTGGGGGCAGAATGACGCTGATTCGGGGCTATTGATCTCTCCCTCCCCTCTATATGGGGTCAGTAGTTTGATCGGAGCGCGCGCAGGAACACCGAAGAGACACACGCGCTTTTACCATGTAACATGAAGCGGTGCGTGTAGACAGATCCAACCGGACACTCATCACCAATCCAATCCCGTCCGTCCAACCTGATGACAGGAAATAATAAGATTATCAAGCAGGACAGGAGAGCGACGCGTTATATCTTTGGAGAAAAGTAACTGGTGTGGATTTGACAGATGACGGTGCGCTCGAGATCCACAGATCTGACCATGAAGCCGTCCAGAATCTCCGTGATGATGATGTTCATCTTCGCATCTGTTCATATCTCGTGCCCATCGCAGTTTCCCAGTCCGCTCATG[T/C]AAGTTCTTTGATGTTGTTTTCGCGTCAACTGGTGATTAAATACAGCTTTTTTCCCCTTTCATGCAGCATCTTTATGTCTCTTTCAACATGCGTGTTTGTAAGTTTTAGTGAGAGTGTGGATCGTGCTGGATGGACAAAACACAAAACAATTGATTTAGTTTGTGTATTTCCAGCCTTATGGTCAATTATAACCCAACAAAAGCTGAAATGTATACTTAGATATGATTCTGGATGTATGTTTTGTTTACAGTTGTTTAATAGTCAAGCAGATACATCCACAATCAATATTATGAATTTGCTGAATGATTAAAAGGGAGGAGTCATAGTGTACATAGCCTACCGTTATTGATTTGTTTAATGAAAAAGCTTGTTTCCAGGACCAGTTCACTCGATTCTGTTTTTATTCACACACTCTCATGTTGCACAAAAGCTGACTTTATTCTGGTGAATTGTTTTTTTTTCCTCGTGACAGCTGTCAAAATCCAACCAAAAGAACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39191
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080995 Essential Splice Site 68 548 2 18
ENSDART00000143965 None None 76 None 3
Genomic Location (Zv9):
Chromosome 18 (position 9205017)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9781994
GRCz11 18 9751184
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTGGTTTCATTAGCAGACACAGCCAGTGCTGGAGATAATCTGAGACAG[G/A]TCAGAGGTCTAAAACTTCTCACATGCACACAGTCTCACACACACAAATAC
Long Flanking Sequence:
TAGTTCCAGTCATCAAGGCTACATGAACTAATTAAAGCCCCCAACATTTACAAAACCTCATGAAATAAAGACCATTTTTGTGTTAAAGTGTATTTGAATTGTGGTGTGTTTATACTGAAGAACAGTTTTATTTTCTCTAGGTTATTCATGTGGAGTACTTACTTTGGTTTGCTAAGTAACTATTAATTTTTATTTGTGGCACTATTTTATGCACCTGCCATTTACTCGACTGTGATATGACTCGCTTGTTTTGCCCTTTTTATGGTTATGACTTAGTTACTCCATACAGAATTAATTATCACATTTTTTGACCACAAAAGTATGCATACAGATCTGACTATCCATCTGTCTGTCCGTCCATCCGTCTGTCTATCTGTTAATTTATTTCCATAACTAATAAGAGTGTTTGTGTTTACAGGATAAAAGAGTGGGTAGATCAGCTGCAGCAAGAGCTGGTTTCATTAGCAGACACAGCCAGTGCTGGAGATAATCTGAGACAG[G/A]TCAGAGGTCTAAAACTTCTCACATGCACACAGTCTCACACACACAAATACTTGTATACATGGTTTATGGGGACATTCTCTTGGCATATTGTATTTTATTCAGCAGAAAACGCACATTACATGACCCTTCGCCACCCCAAACCTAACCCTCACAGGAAACCTATGGCAAAATTTGATTGTTAAAAGTCCCCCTTCAGTATGATTTTAAGCACTTTTTATTAATTACAGAGACACGAGACACAGTAGAGTACATTGTCATAACCATGAAAATATACAACTTTGTGTCCCTGTAAACCTGTACACACACATACACACCCCTGAGCATAGTGATAAATGTGGATTTGATGTGTATTTACACAAGCAAATTGTGAGTGAGAGTTAAGCCTCAATAAAAGCATGCTTAATTATCAAAACAATCATTACCAGTAAGCCGTCATCTCGTTAGTTCATTAGGAGAGCCCCTAATGAGTGTCTTTTCCTCTCCGTTATTGCAGATCTTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28984
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080995 Essential Splice Site 127 548 4 18
ENSDART00000143965 Essential Splice Site 20 76 1 3
Genomic Location (Zv9):
Chromosome 18 (position 9264536)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9841513
GRCz11 18 9810703
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCAGCAGAGAATTTCCAAATGGAGCATCAATGGAAAGATGAATTTGCAG[T/G]AAGTACTTCTGCGACAAGTGCATGCTGAAAGTTTACAAAGGGCTAGACAT
Long Flanking Sequence:
CACCATGAAACAGAAGTTAAGATTGTTCGTTTTTTCTCCCTATTTTGACATACATCTGGTTCTGAAATAAAAAATAAAAAAAGTAGGGTAGTGCATGATTTTGTATTTTGGGAACTAATTGGATTATTAGAAGATCAGCATTTATAACAAAATGAAGGAGGAAAGCAGGGCAGAAACAAGACACATCGCGATAGCCCCTCCTGAAAGGCATTCCATGTGACCATGTAATCATTTCGAGGAGGCAGGGAAGGTTATGGTATTTGATAAAAGATTTAGAAAGCAAATTAATTTTTACAAAACAATAAAGTGCACAGATACATCATTTATAACAAATGCTACTATATAAATCCAGATATCTCATTATATGACTTTCCTTGATCACTGATATTTTAATGAATGTGTAACTAATTATATGATTTCTTTGTTGTTGTTTTCATAGACTTTGGCAACCGCAGCAGAGAATTTCCAAATGGAGCATCAATGGAAAGATGAATTTGCAG[T/G]AAGTACTTCTGCGACAAGTGCATGCTGAAAGTTTACAAAGGGCTAGACATGTATATTATATTACATCCTATCAGATTTTCTTTCACAGCCAGTTGGCTTTACATGTTATCCACTTACTGTCAAGTTACAGGAGTGAGAAACACATTTAACGGTGTATAGGGGTGAATTAAATCATGCATAATTTTGCGTGTGTTTCGGTTAAAATTATCCAGTTTCTGGTCACAATATTTTGGTATATGGCTTATTTTCAAGGTACAGTTTGTGGGGTTTACGCTAAATTATGCACTGCTTTTTATTTACAGTATCTTTTACAAGATCTGGCAACCTTTACTACTGTGTGATGCATATACAACAGAATTTTAGCAAACACTATACTGAAGCTAAGCACGGCTGAGCCTGGTCAGTACCTGGATTGGAGACCACATGGGAAAACTAGGTTGCTGTTGGAAGTGGTGTTAGTGAGGCCAGCTGGAGCGCACATCCTGCGGTCTGTTTGAATC
Associated Phenotype:
Not determined