Busch Lab

ZMP

nlrx1

Ensembl ID:
ENSDARG00000073724
ZFIN ID:
ZDB-GENE-071119-3
Human Orthologue:
NLRX1
Human Description:
NLR family member X1 [Source:HGNC Symbol;Acc:29890]
Mouse Orthologue:
Nlrx1
Mouse Description:
NLR family member X1 Gene [Source:MGI Symbol;Acc:MGI:2429611]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6376 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35882 Nonsense Mutation detected in F1 DNA Not yet available
sa15956 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6376
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114416 Essential Splice Site 59 1005 2 8
Genomic Location (Zv9):
Chromosome 15 (position 22833822)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23545009
GRCz11 15 23480274
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCTGGCATCTGCAGAAATATAAAGCGATGTCACTTGTCATTCCCAATG[T/A]AAGTATTATAAGAAATAAACTTTTTMTAAWGTTTTTATTTCAAAYAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35882
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114416 Nonsense 771 1005 5 8
Genomic Location (Zv9):
Chromosome 15 (position 22828206)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23539393
GRCz11 15 23474658
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTCCTGCCACATCACGCCAGAACTGCTGCAGATGCTTTGGCCAGCCTTC[C/T]GACACACCAGAAACCTCAAGTGAGACATCCACTTACTAATATGGATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15956
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114416 Nonsense 908 1005 8 8
Genomic Location (Zv9):
Chromosome 15 (position 22822664)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23533851
GRCz11 15 23469116
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTACCTGAATCAGCTYACCGACGTGGCCAAGCAGTCTTTATATGTGCGT[G/T]GAGGTCCTCGGGTRAAGGAGGGCCGGCGGGTKAAAGTCCTGGCTTCTGTG
Associated Phenotype:
Not determined