Busch Lab

ZMP

si:dkey-76p7.6

Ensembl ID:
ENSDARG00000073721
ZFIN ID:
ZDB-GENE-091113-61
Human Orthologue:
SMARCAD1
Human Description:
SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing D
Mouse Orthologue:
Smarcad1
Mouse Description:
SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing D

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa11433 Nonsense Available for shipment Available now
sa41629 Nonsense Mutation detected in F1 DNA Not yet available
sa21706 Nonsense Available for shipment Available now
sa41628 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11433
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113101 Nonsense 366 954 9 23

The following transcripts of ENSDARG00000073721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17601581)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17613927
GRCz11 10 17571361
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAAAGAGCAACACTTTCACKCTTCTTTGTCTCAGGATGATGCCATGCGC[A/T]GAAGAAACGGTYTGTCCGCTGAGCTCCTGGCAGGATGTCGAGAGGTTCTG
Long Flanking Sequence:
GAAACAAAGCAGCTGCTTGCCATCGCGACAGCAATAAGATCCAATGGACAGCCGATCACTTTCACTCCAAAATGGTGGAATCCGGGGCTGTTGCTGGGTGCTGCTGTTCAATTGAGTGTTGCCTCTTGGTCATTCTAAGCTCTTTGCCTGTATATACAATCCTGTGCAATATTTTATATTGTATATATTTCTATAATTTACTCACTATCCACTTGTTACAAAACCTGTTTTACTTTCTTCTGTTTACCACAAAAGTAGATATTTTGAAGAATGTTGAAGCCTTCTACAGCATTTTTACATACTATAGCCATCAATGGCATCAGTTTCTGACATTCTTCCAAATATCTGCTTTTGTGTTCAACAGAAGAAAGGTTTGGGAACACTTGAGGGTGAGTAAAAGGTGTGCACATGTCACTTTTCTCTGCAACTGCCAGAACATTTAGGTTATGATCAAAGAGCAACACTTTCACTCTTCTTTGTCTCAGGATGATGCCATGCGC[A/T]GAAGAAACGGTCTGTCCGCTGAGCTCCTGGCAGGATGTCGAGAGGTTCTGAAGGAGAGGGAAGTTGTTAAAGGTCTCATGAGCAAGTGTGAGGAGATTTCAGTCAAACTGATCCAAGACGTGACGCAAGTAATGGACAAGGGCCCGGGCTCCATGACCCAGCCCGAGATCCTCTCTAGCACGTAAGATATTGCATCACAGCTTTGAAAATCGGCTTTATAAGGTGATAGGTTGTAAAATTTCTGTGGCGTAATTATTTTTTTATGGGTTTTTTTCTAGATTCCAGTTGAAACCGTACCAGCTGATTGGCCTGAATTGGCTGGTTTTGCTTCATCAGAACAAACTCAGTGGAATCCTGGCAGATGAGATGGTAATGGAGTACCGGTCTAAATTAATAATATTGGAATCATTTAGGCAATCTCTTCTTATCATTGTGAACAGCCCAAAAAATCACAATAAAATGTAAAAAATTATGAACAAATTCTGTAAAATACTTTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41629
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113101 Nonsense 660 954 17 23

The following transcripts of ENSDARG00000073721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17593495)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17605841
GRCz11 10 17563275
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTCGAGTGGTTCACTGACAGATGATGATGTGCCCGACAGGTCCTGAAG[C/T]AGCTGCCTGCCAAAGAGGAGCAGGTTGAATTTTGTGCCATGTCCGAGAGG
Long Flanking Sequence:
TAACTCCTTAACAACAACCTAGTAACCACCTGATCATGCCCTCAAACACTAGAAAGATCACAGAATGCCTTAGCAACACCTTAGTAACTATCTGGTTATGGACATAAGCAACCATCCAGAGTGCCCTAGAGTCAAGGCAGGCACCAAATCCTAAAGTAAAAATGTAGTTCCAGATATATCTGTTTCCTGCAGAAATCGTCAGAGGAGCAGAGCAGCTTTGAGCGGGACAGGATCACCCATGCCAAGCTCATCATGAAACCCTTCATCCTCAGACGTGTGAAGAGCGAGGTGCATCTGCATACATAGTCTATAAGCGTTGTGCATAATGCATGCGCTCTCAGAATGCATGCCAATGTGAAAATCTGTTGGACAACATCTCAAATGCATTATTCAGTCTCATGAGCAGATGAGGCACTTTGCTTGTCATGTTGACCCTCGATGACTCTGGGGCACTCGAGTGGTTCACTGACAGATGATGATGTGCCCGACAGGTCCTGAAG[C/T]AGCTGCCTGCCAAAGAGGAGCAGGTTGAATTTTGTGCCATGTCCGAGAGGCAGCAAGAACTCTACAGCGCCCTTCTCCACAAGCTGAAGCATTCTAGTAATGGGGAAAGTATGTATTTGAGGAAGGTGGTGTTATTAAAGAGACTGGTAAATGTGACCCGTTTCATAACCTTGGGTTTCTGCAGAACGCGAGCTGACCAATGTGATGATGCAGCTGAGGAAGATGTCCAACCATCCGCTTCTTCACCGGCAGTTTTACACCACAGAAAAACTCAAAGCCATGAGCAAACTCATGCTCAAGGTCTGAGATATTTTCGTATGAAGTGCTGCATTTTGATTAATGCCACAGGACAGTTAGATACTAGCAGGGCCAGACAGAATTGGTGGCTGTTTTGTATTTTCTGTGCTGATTTTAAGTAGGTCAAGGGAGCCAGACGTTTGACTATTGCATGAAGTCTGGTACAATTTTTGGTTTATTCAGCCCAAGAACCATTTATTTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1233
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113101 Nonsense 678 954 17 23

The following transcripts of ENSDARG00000073721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17593441)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17605787
GRCz11 10 17563221
KASP Assay ID:
554-1142.1 (used for ordering genotyping assays)
KASP Sequence:
TGCCTGCCAAAGAGGAGCAGGTTGAATTTTGTGCCATGTCCGAGAGGCAG[C/T]AAGAACTCTACAGCGCCCTTCTCCACAAGCTGAAGCATTCTAGTAATGGG
Long Flanking Sequence:
AGATCACAGAATGCCTTAGCAACACCTTAGTAACTATCTGGTTATGGACATAAGCAACCATCCAGAGTGCCCTAGAGTCAAGGCAGGCACCAAATCCTAAAGTAAAAATGTAGTTCCAGATATATCTGTTTCCTGCAGAAATCGTCAGAGGAGCAGAGCAGCTTTGAGCGGGACAGGATCACCCATGCCAAGCTCATCATGAAACCCTTCATCCTCAGACGTGTGAAGAGCGAGGTGCATCTGCATACATAGTCTATAAGCGTTGTGCATAATGCATGCGCTCTCAGAATGCATGCCAATGTGAAAATCTGTTGGACAACATCTCAAATGCATTATTCAGTCTCATGAGCAGATGAGGCACTTTGCTTGTCATGTTGACCCTCGATGACTCTGGGGCACTCGAGTGGTTCACTGACAGATGATGATGTGCCCGACAGGTCCTGAAGCAGCTGCCTGCCAAAGAGGAGCAGGTTGAATTTTGTGCCATGTCCGAGAGGCAG[C/T]AAGAACTCTACAGCGCCCTTCTCCACAAGCTGAAGCATTCTAGTAATGGGGAAAGTATGTATTTGAGGAAGGTGGTGTTATTAAAGAGACTGGTAAATGTGACCCGTTTCATAACCTTGGGTTTCTGCAGAACGCGAGCTGACCAATGTGATGATGCAGCTGAGGAAGATGTCCAACCATCCGCTTCTTCACCGGCAGTTTTACACCACAGAAAAACTCAAAGCCATGAGCAAACTCATGCTCAAGGTCTGAGATATTTTCGTATGAAGTGCTGCATTTTGATTAATGCCACAGGACAGTTAGATACTAGCAGGGCCAGACAGAATTGGTGGCTGTTTTGTATTTTCTGTGCTGATTTTAAGTAGGTCAAGGGAGCCAGACGTTTGACTATTGCATGAAGTCTGGTACAATTTTTGGTTTATTCAGCCCAAGAACCATTTATTTCTGCAGGGAGAGGCATGCGTTTTAAGCCTAGTTTAGGAGACATTTTTCTAGAGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21706
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113101 Nonsense 924 954 22 23

The following transcripts of ENSDARG00000073721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17583418)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17595764
GRCz11 10 17553198
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAAGGACTCCATAGAGGACACCATGCTTCGAATTGGAGAAAGAAAACTC[A/T]AACTAGAGCAGGAAATGACCGCAACTCAGGACGGTGAGAACACTAATAAA
Long Flanking Sequence:
TTATAAATAGTAATATCCTGTCAATTAATGTGACATCCACGAAGTTTAGCACAATCTAAATGTAATCCAAAAGTAGTCTGATTTTATTGCCATATACATGTAATCCAGGACAGTGTTTCTCAACCACGTTCCTGGAGGACCACAAGCTCTGCACATTTTCCATTTCTCCTTAATCCAACACATCTGATTTAGATCGTCAGCCCATTAGCAGAGATTAAAAGACTTGAAATGGGTGTGACAAACAAAAGAGACATCTAAAACCTGCAGTGTTGGTGGTCCTCCAGGAACGTGGTTGAGAAACACTGAGCTAGATTATATCACTGACTACAAATTTTGTTGTGTAATTTGTCATCTGTAACTGTTTAGAATTCATGAGTAATCCACCCATCTCTGACCTCATCTGACTGCATTTGTTCCGTTTAAGGACCGTGAAGGTGATCAAGCTGATAAGTAAGGACTCCATAGAGGACACCATGCTTCGAATTGGAGAAAGAAAACTC[A/T]AACTAGAGCAGGAAATGACCGCAACTCAGGACGGTGAGAACACTAATAAAGCTGACAGGGATTTTATTTACCTGACCTATGTTTTTCTTTTGTACTGTGAATACAGATATGCTTGTTTCTTTCAGGCGAAGAAGACACATTACCTGATGATATGACCACGCTGCTCAAAGCTTCTCTCGGGCTCTGAAAGTTGGTCCAGGAGTAAAGCTTGTTGTGATACTATGACTGAATCTGAAAGAAAAAGTACTGTAGCACAATAAAATCTGGTTTTCCTACACCACCTGCAGAAATATGCGATTCAAATGAGCTGATTTGTTTACATTTCTACTGTTCATTGCAAAAGATGATGTAATATTGTATGTGTGTTGATGGTGCTTGTATTTGTGAAGGTTTAAATCTGCAGTTGTTTGGTTAAAAAAGTCTGTTTTTCAAAGATATTTGGGGGGGGGATTAAAATATTTGTTTATTTGCTCTTTTAGTCTGAGATGGTTACAATTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41628
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113101 Essential Splice Site 935 954 22 23

The following transcripts of ENSDARG00000073721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17583383)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17595729
GRCz11 10 17553163
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGAAAGAAAACTCAAACTAGAGCAGGAAATGACCGCAACTCAGGACGG[T/A]GAGAACACTAATAAAGCTGACAGGGATTTTATTTACCTGACCTATGTTTT
Long Flanking Sequence:
TCCACGAAGTTTAGCACAATCTAAATGTAATCCAAAAGTAGTCTGATTTTATTGCCATATACATGTAATCCAGGACAGTGTTTCTCAACCACGTTCCTGGAGGACCACAAGCTCTGCACATTTTCCATTTCTCCTTAATCCAACACATCTGATTTAGATCGTCAGCCCATTAGCAGAGATTAAAAGACTTGAAATGGGTGTGACAAACAAAAGAGACATCTAAAACCTGCAGTGTTGGTGGTCCTCCAGGAACGTGGTTGAGAAACACTGAGCTAGATTATATCACTGACTACAAATTTTGTTGTGTAATTTGTCATCTGTAACTGTTTAGAATTCATGAGTAATCCACCCATCTCTGACCTCATCTGACTGCATTTGTTCCGTTTAAGGACCGTGAAGGTGATCAAGCTGATAAGTAAGGACTCCATAGAGGACACCATGCTTCGAATTGGAGAAAGAAAACTCAAACTAGAGCAGGAAATGACCGCAACTCAGGACGG[T/A]GAGAACACTAATAAAGCTGACAGGGATTTTATTTACCTGACCTATGTTTTTCTTTTGTACTGTGAATACAGATATGCTTGTTTCTTTCAGGCGAAGAAGACACATTACCTGATGATATGACCACGCTGCTCAAAGCTTCTCTCGGGCTCTGAAAGTTGGTCCAGGAGTAAAGCTTGTTGTGATACTATGACTGAATCTGAAAGAAAAAGTACTGTAGCACAATAAAATCTGGTTTTCCTACACCACCTGCAGAAATATGCGATTCAAATGAGCTGATTTGTTTACATTTCTACTGTTCATTGCAAAAGATGATGTAATATTGTATGTGTGTTGATGGTGCTTGTATTTGTGAAGGTTTAAATCTGCAGTTGTTTGGTTAAAAAAGTCTGTTTTTCAAAGATATTTGGGGGGGGGATTAAAATATTTGTTTATTTGCTCTTTTAGTCTGAGATGGTTACAATTTTGCTCTGGGTTTTGGCTTTTAAGATTGAGTTTTCTCA
Associated Phenotype:
Not determined